Share
Explore BrainMass

Genetics

Progress of gene therapy

Give your opinion as to why the progress of gene therapy has been disappointingly slow. Give several specific examples of actual failures in gene therapy trials. Suggest the most promising avenues for future gene therapy research. What is your personal opinion of the future of gene therapy?

Classical Genetics - Probability Lab

Please find the questions in the attachment. _________________________________________________________________________________________________________________ ? Predict the probability of the occurrence of a single event. ? Predict the probability of two independent events occurring at the same time. ? Apply Mendel's la

Genetics and learning

Analyze the relationship between genetics and learning. Examine individual differences in learning and memory. A short answer in 400 words.

Fertilization /genetic trails

1- list the steps in the process of the fertilization of an ovum. 2- describe the differences between recessive, dominant, and co-dominant genetic trails.

Cell Biology: Compare and Contrast Mitosis and Meiosis

At one time, organisms were only the size of one cell; they divided and developed into the individuals like humans that are made of trillions of cells. Every cell in the human body received a copy of an original nucleus with the exact same genes and chromosomes. All of the cells in the body evolved from a single cell. Mito

Mutations in codons

I am working on a genetics assignment and am completely stumped on this problem. I have looked at it for hours and cannot figure it out. The biggest problem I am running into what kind of mutagen could induce these specific changes. I've tried various ways of frame shifting, but nothing seems to be working here. Please help!

Factors Affecting Fetal Development

Can you explain how a woman might impact development of the fetus, taking into consideration the influence of environmental and genetic factors?

Analyzing Research Questions

In the world of research you can find many research articles on any topic in many peer reviewed journals. Access a scholarly, peer-reviewed source and locate at least four articles on either qualitative or quantitative research containing research questions, as well as determine if they are good or bad questions.

Mouse Strain Nomenclature

Using the following examples, describe the components of mouse strain nomenclature and their significance. a) FVB.129P2-Apoe<tm1Unc> b) C57BL/6-Tg(CAG-cre)13Miya c) B6.Cg-Hprt<tm319(CAG-cre)Ems>

Genetics Affecting Biotechnology Process

1. Define biotechnology and list 3 ways biotechnology has affected human society. 2. Explain the process of gel electrophoresis in detail. Give me a step by step explanation of how this works and what it is used for. 3. Explain the process of DNA fingerprinting (DNA profiling) in detail. Give me a step by step explanation o

The process of protein production

A diagram of the process of protein production beginning with transcription of DNA and ending with the production of a polypeptide (protein) from RNA translation at the ribosome. The diagram provided takes the student through each step of the process including: 1. DNA transcription 2. mRNA translation 3. The genetic code.

Punnett Squares: Representing Mendelian Inheritance

Punnett squares for monohybrid crosses are relatively straightforward until we begin to consider x-linked (sex-linked) traits. This looks at the basics of punnet squares and notation that can help you to solve them and keep track of what is going on. Three problems are addressed here. First, we look at the case of a straightforw

The Future of Toxicogenomics

How will toxicogenomics, which is the analysis of the effects of toxic chemicals on genes (for example, gene mutations or changes in gene expression), be influential in the next decade? Please provide details and specific examples.

Synthetic Genetic Engineering Technology

I am doing a research paper and I need opinions. The question: "is it appropriate to use emerging synthetic genomic engineering technology to build new forms of "life"? I would appreciate pros and cons as part of my research. The explanation is given in 300 words.

Relation between telomeres and aging

One aspect of aging appears to be related to telomeres. Every time a chromosome is duplicated in the S Phase of interphase, the ends of the chromosome (i.e. telomeres) unravel. This sets a limit of around 50 cell divisions before the chromosome unraveling effects genes. Explain the significance of this.

DNA & Avery, MacLeod and McCarty's Experiment

Can you provide an overview (abstract) of Avery, MacLeod and McCarty's important experiment demonstrating that DNA is the transforming principle. When I say "abstract", I mean a brief summary of the research, including details about how the experiment was carried out, and what the results were. Please also provide reference

Design Experiment: DNase

DNase hyper sensitive sites are important for changing chromatin structure during transcriptional activation of genes. Use BOTH diagram & written explanation: Determine whether DNase (HSS) formation at specific sites in promoter regions is an important component of transcriptional activation of a gene you are studying duri

Gene Mutations (Base Substitutions, Insertion & Deletion)

Discuss the three different types of gene mutations (base substitutions, insertion & deletion). Please describe in detail how insertion, deletion, and base substitution of nucleotides can have a significant impact on genes, and provide three specific examples (actual gene mutations, not chromosome mutations) of ways in whic

Relative Fitness and Absolute Fitness using Selection Coefficient

The coefficient for selection between Zid+ and Zid- in common garden experiment of an individual being treated with AZT is 0.036, indicating selection for Zid-. What are the relative fitnesses of Zid- and Zid+? Absolute fitness of Zid+ in AZT treated people is 1.040. What's the Absolute fitness for Zid-?

Relating Mendel's Law to Meiosis

Please relate Mendel's Law of Segregation and Law of Independent Assortment to meiosis and please describe the stages of meiosis that demonstrate these laws.

How biology and genetics may influence substance abuse and addiction.

Researchers have long been asking the question of what causes addictive behavior and why some people feel compelled to keep abusing substances they know are harmful and detrimental to themselves. Growing evidence suggests both the biologic and genetic basis of addiction, which may explain this apparently self-destructive behavi

How to read and understand a scientific journal article.

In this Nature journal article about the dog genome, how do I answer the following questions? What was the author's purpose? Why did the author decide to sequence the domestic dog's genome? What are 3 major conclusions that you learned from this paper? What future experiments did the authors propose, now that there is a d

Single Substitution Polymorphism

5'tggtggtggaggctggggtcaaggtggtagccacagtcagtggaacaagcccagtaagccaaaaccaacaygaagcatgtggcaggagctgctgcagctggagcagtggtagggggccttggtggctacat3' Can this sequence be cut by a restriction enzyme? Can the fragments and coupled with electrophoresis be used to find a single substitution polymorphism?