Explore BrainMass


DNA & Avery, MacLeod and McCarty's Experiment

Can you provide an overview (abstract) of Avery, MacLeod and McCarty's important experiment demonstrating that DNA is the transforming principle. When I say "abstract", I mean a brief summary of the research, including details about how the experiment was carried out, and what the results were. Please also provide reference

Design Experiment: DNase

DNase hyper sensitive sites are important for changing chromatin structure during transcriptional activation of genes. Use BOTH diagram & written explanation: Determine whether DNase (HSS) formation at specific sites in promoter regions is an important component of transcriptional activation of a gene you are studying duri

Gene Mutations (Base Substitutions, Insertion & Deletion)

Discuss the three different types of gene mutations (base substitutions, insertion & deletion). Please describe in detail how insertion, deletion, and base substitution of nucleotides can have a significant impact on genes, and provide three specific examples (actual gene mutations, not chromosome mutations) of ways in whic

Relative Fitness and Absolute Fitness using Selection Coefficient

The coefficient for selection between Zid+ and Zid- in common garden experiment of an individual being treated with AZT is 0.036, indicating selection for Zid-. What are the relative fitnesses of Zid- and Zid+? Absolute fitness of Zid+ in AZT treated people is 1.040. What's the Absolute fitness for Zid-?

Relating Mendel's Law to Meiosis

Please relate Mendel's Law of Segregation and Law of Independent Assortment to meiosis and please describe the stages of meiosis that demonstrate these laws.

How biology and genetics may influence substance abuse and addiction.

Researchers have long been asking the question of what causes addictive behavior and why some people feel compelled to keep abusing substances they know are harmful and detrimental to themselves. Growing evidence suggests both the biologic and genetic basis of addiction, which may explain this apparently self-destructive behavi

How do you understand the information provided in a journal article? Where can I find information specifically about why the authors wrote the paper, major conclusions drawn, etc.?

In this Nature journal article about the dog genome, how do I answer the following questions? What was the author's purpose? Why did the author decide to sequence the domestic dog's genome? What are 3 major conclusions that you learned from this paper? What future experiments did the authors propose, now that there is a d

Find an appropriate restriction enzyme

5'tggtggtggaggctggggtcaaggtggtagccacagtcagtggaacaagcccagtaagccaaaaccaacaygaagcatgtggcaggagctgctgcagctggagcagtggtagggggccttggtggctacat3' Can this sequence be cut by a restriction enzyme? Can the fragments and coupled with electrophoresis be used to find a single substitution polymorphism?

Deciphering the information provided in gene annotations

Describe the E-value distribution are they small (close to zero) large (close to 1). Is the subject sequence from the top 2 BLAST hits from a genus and or a phylum that you would expect to be closely related to T. oceani? Are there any inconsistencies found in the T-coffee results, such as large polypeptide regions that

Chi Square

Gregor Mendel discovered that tall was dominant and short recessive in pea plants. When he crossed two plants that were both heterozygous tall (Tt) he found a 3:1 ratio of tall to short (75% tall, 25% short) in the offspring leading him to conclude that in a monohybrid cross, the offspring would show a 3:1 ratio of dominant to

Probability Punnet Square

In couples where each person is heterozygous for the sickle-cell gene, there is a probability of 0.25 that any child of the couple will have the disease. A husband and wife, who are both heterozygous for the sickle-cell allele, are planning to have a family of four children. What is the probability that their first child wil

genotypes of gene interaction problem

A locus in mice has been identified as determining pigment production.When parents heterozygous at this locus are mated, 3/4 of the progeny are coloured and 1/4 are albino.Another locus determines the actual coat colour; for example, when two yellow mice are mated,2/3 of the progeny are yellow and 1/3 are agouti.It was noticed t

Data analysis

Could you please help me with the following genetic data analysis?: 1 2 3 4 5 6 7 8 9 10 11 12 - - - - - - - - - - - - - - - - - - -

Implementing Leadership Change within GeneOne!

See attached case study file. Write a proposal for facilitating change within GeneOne. Determine two possible strategies that the remaining leadership of GeneOne could use to lead the company to two distinct but desirable outcomes while remaining an innovative organization. Integrate the following into the strategies p

Need guidance with ethics

Please guide me with my homework: I will be given a scenario which has ethical implications. I will need to analyze the scenario and identify who the effected parties are in the scenario and what the possible effects or outcomes, the question is: Ethics of Gene testing: Summative assessment Read the following scena

Summarize gene testing & research.

Using the 11 leading causes of mortality in the United States in 1999 (Lecca, Valentine, & Lyons, 2003, p. 240), what roles do genetics, gene testing, and research play in the progression or cessation of disease? following is a list of the leading causes of mortality on the US in 1999: 1) Diseases of the heart (30.3 percent

Hypothesis Testing

Given that Ho = null hypothesis and Ha= alternative hypothesis then consider the following situations. 1. You are a juror in a murder trial. State the null and alternative hypothesis and explain why. What are two mistakes that can occur here (the two mismatches between what reality is and what the decision is). 2.

Find sequence similarity between two 100 Mb DNA sequences.

Q1) Determine where and how similar two 100 Mb DNA sequences are. Assume that similarity will vary over the lengths of the sequences. 1.Restate the biological problem in computational terms. 2.What kinds of data do you need? 3.What controls do you need? 4.Do you need to define the problem's conditions more precisely?

Dihybrid crosses: Using the principles of Mendelian genetics, determine the genotypes and phenotypes of the resulting offspring from a parental dihybrid cross. The solution demonstrates how to find the phenotypic and genotypic ratios of the resulting progeny.

A scientist studying diploid pea plants is interested in two particular traits of the plant: pea color and pea texture. From previous studies, the scientist knows these traits to be genetically unlinked; therefore, these traits follow the Mendelian principles of segregation and independent assortment. The scientist also knows th

Complete the genome of this particular organism.

Given the complete sequence of an organismâ??s genome, 500 Mb, find motives that might regulate genes, based on the putative motivesâ?? proximity to known expressed genes. These motives are likely to occur relatively infrequently (ca. 1 motif/50 Kb). Use the flow chart which I'm attaching because will help you, now answer

Crossing pure-bred plants

Each plant was crossed with normal (leafy) pure-bred plants to generate the following phenotypic ratios: F1 phenotype F2 phenotype Line 1 x leafy all leaves 3:1 leaves/no leaves Line

Genetic Problems

Solve all of these problems using a Punnett Square. If you cannot reproduce the square using software, then you may do them by hand and scan in the image of your solution and submit all images in the one document. In the eastern collared lizard, Crotaphytus collaris, commonly known as Mountain Boomers, the genes for length of

Dihybrid Problems

Solve all of these problems using a Punnett Square. If you cannot reproduce the square using software, then you may do them by hand and scan in the image of your solution and submit all images in the one document. In certain bacteria, an oval shape (A) is dominant over round (a) and thick cell walls (B) are dominant over thin

Monohybrid Problems

Solve all of these problems using a Punnett Square. If you cannot reproduce the square using software, then you may do them by hand and scan in the image of your solution and submit all images in the one document. In summer squash, white fruit color (W) is dominant over yellow fruit color (w). If a squash plant homozygous for

Gene frequency is explicated.

One-thousand individuals were screened for their genotype at the MN blood group locus. The numbers of each genotype were: MM MN NN 298 489 213 Assuming random mating, calculate the gene frequency for the M allele and the expected genotype frequencies. Use the chi-squared test to determine that mating is r

Mutation Rate, Frequency, and Lifespan

Could you please help me with an assignment by discussing the following topic: Compare and contrast mutation rate and mutation frequency. Describe the implications for organisms that have long life spans (e.g., humans) and short life spans (e.g., mice). Spontaneous mutation rates in humans are generally higher than in E. coli