Give your opinion as to why the progress of gene therapy has been disappointingly slow. Give several specific examples of actual failures in gene therapy trials. Suggest the most promising avenues for future gene therapy research. What is your personal opinion of the future of gene therapy?
Please find the questions in the attachment. _________________________________________________________________________________________________________________ ? Predict the probability of the occurrence of a single event. ? Predict the probability of two independent events occurring at the same time. ? Apply Mendel's la
Analyze the relationship between genetics and learning. Examine individual differences in learning and memory. A short answer in 400 words.
1- list the steps in the process of the fertilization of an ovum. 2- describe the differences between recessive, dominant, and co-dominant genetic trails.
At one time, organisms were only the size of one cell; they divided and developed into the individuals like humans that are made of trillions of cells. Every cell in the human body received a copy of an original nucleus with the exact same genes and chromosomes. All of the cells in the body evolved from a single cell. Mito
I am working on a genetics assignment and am completely stumped on this problem. I have looked at it for hours and cannot figure it out. The biggest problem I am running into what kind of mutagen could induce these specific changes. I've tried various ways of frame shifting, but nothing seems to be working here. Please help!
Can you explain how a woman might impact development of the fetus, taking into consideration the influence of environmental and genetic factors?
In the world of research you can find many research articles on any topic in many peer reviewed journals. Access a scholarly, peer-reviewed source and locate at least four articles on either qualitative or quantitative research containing research questions, as well as determine if they are good or bad questions.
What are genetic, chromosomal, environmental, and psychosocial causes of Intellectual Disabilities?
Please help with the following problem. Discuss the significance of Mendel's work and its impact on today's biological advances.
Using the following examples, describe the components of mouse strain nomenclature and their significance. a) FVB.129P2-Apoe<tm1Unc> b) C57BL/6-Tg(CAG-cre)13Miya c) B6.Cg-Hprt<tm319(CAG-cre)Ems>
1. Define biotechnology and list 3 ways biotechnology has affected human society. 2. Explain the process of gel electrophoresis in detail. Give me a step by step explanation of how this works and what it is used for. 3. Explain the process of DNA fingerprinting (DNA profiling) in detail. Give me a step by step explanation o
A diagram of the process of protein production beginning with transcription of DNA and ending with the production of a polypeptide (protein) from RNA translation at the ribosome. The diagram provided takes the student through each step of the process including: 1. DNA transcription 2. mRNA translation 3. The genetic code.
Punnett squares for monohybrid crosses are relatively straightforward until we begin to consider x-linked (sex-linked) traits. This looks at the basics of punnet squares and notation that can help you to solve them and keep track of what is going on. Three problems are addressed here. First, we look at the case of a straightforw
Where can I find the DNA sequence for the Factor V Leiden mutation?
How will toxicogenomics, which is the analysis of the effects of toxic chemicals on genes (for example, gene mutations or changes in gene expression), be influential in the next decade? Please provide details and specific examples.
I am doing a research paper and I need opinions. The question: "is it appropriate to use emerging synthetic genomic engineering technology to build new forms of "life"? I would appreciate pros and cons as part of my research. The explanation is given in 300 words.
One aspect of aging appears to be related to telomeres. Every time a chromosome is duplicated in the S Phase of interphase, the ends of the chromosome (i.e. telomeres) unravel. This sets a limit of around 50 cell divisions before the chromosome unraveling effects genes. Explain the significance of this.
1. What is the state of the DNA at the end of meiosis I? What about at the end of meiosis II? 2. Why are chromosomes important? 3. How are Meiosis I and Meiosis II different? 4. Name two ways meiosis contributes to genetic recombination. 5. Why do you use non-sister chromatids to demonstrate crossing over? 6. Why is it nec
Your colleague has an EST fragment from E. coli with the following sequence: AAGUCAUUAUUUUCG. Assuming this is the coding strand, can you help her to identify the most likely translation frame?
Can you provide an overview (abstract) of Avery, MacLeod and McCarty's important experiment demonstrating that DNA is the transforming principle. When I say "abstract", I mean a brief summary of the research, including details about how the experiment was carried out, and what the results were. Please also provide reference
DNase hyper sensitive sites are important for changing chromatin structure during transcriptional activation of genes. Use BOTH diagram & written explanation: Determine whether DNase (HSS) formation at specific sites in promoter regions is an important component of transcriptional activation of a gene you are studying duri
Discuss the three different types of gene mutations (base substitutions, insertion & deletion). Please describe in detail how insertion, deletion, and base substitution of nucleotides can have a significant impact on genes, and provide three specific examples (actual gene mutations, not chromosome mutations) of ways in whic
The coefficient for selection between Zid+ and Zid- in common garden experiment of an individual being treated with AZT is 0.036, indicating selection for Zid-. What are the relative fitnesses of Zid- and Zid+? Absolute fitness of Zid+ in AZT treated people is 1.040. What's the Absolute fitness for Zid-?
Please relate Mendel's Law of Segregation and Law of Independent Assortment to meiosis and please describe the stages of meiosis that demonstrate these laws.
Gene is a new staff-level auditor on the audit of CalPower, a publicly traded energy and utility company. On his first day, his senior informs him that the engagement team is scheduled to have lunch with the internal auditor to discuss ways to improve this year's audit. While Gene has heard a lot about internal auditing in s
A step by step example of the Hardy Weinberg equation, with explanations.
Researchers have long been asking the question of what causes addictive behavior and why some people feel compelled to keep abusing substances they know are harmful and detrimental to themselves. Growing evidence suggests both the biologic and genetic basis of addiction, which may explain this apparently self-destructive behavi
In this Nature journal article about the dog genome, how do I answer the following questions? What was the author's purpose? Why did the author decide to sequence the domestic dog's genome? What are 3 major conclusions that you learned from this paper? What future experiments did the authors propose, now that there is a d
5'tggtggtggaggctggggtcaaggtggtagccacagtcagtggaacaagcccagtaagccaaaaccaacaygaagcatgtggcaggagctgctgcagctggagcagtggtagggggccttggtggctacat3' Can this sequence be cut by a restriction enzyme? Can the fragments and coupled with electrophoresis be used to find a single substitution polymorphism?