Explore BrainMass
Share

Single Substitution Polymorphism

This content was STOLEN from BrainMass.com - View the original, and get the already-completed solution here!

5'tggtggtggaggctggggtcaaggtggtagccacagtcagtggaacaagcccagtaagccaaaaccaacaygaagcatgtggcaggagctgctgcagctggagcagtggtagggggccttggtggctacat3'

Can this sequence be cut by a restriction enzyme?

Can the fragments and coupled with electrophoresis be used to find a single substitution polymorphism?

© BrainMass Inc. brainmass.com October 25, 2018, 6:00 am ad1c9bdddf
https://brainmass.com/biology/genetics/single-substitution-polymorphism-444437

Solution Preview

The sequence you mentioned can be cut by a number of restriction enzymes (REs). I find this tool to be very helpful in picking REs: http://tools.neb.com/REBsites/index.php

You basically paste in your sequence and it will tell you the different REs and can generate a virtual gel electrophoresis. In your case there are 49 different REs that can digest your sequence ...

Solution Summary

Find an appropriate restriction enzyme that will cut the given sequence. The solution details how you would go about finding the restriction enzyme. The solution then tells you how, armed with that information how you can go about finding a single substitution polymorphism within that DNA sequence. Some background is provided to explain the answer and help you answer similar questions.

$2.19
See Also This Related BrainMass Solution

How to Calculate Recombination Frequency

Calculate the recombination frequency between RC4-124 and RC-280 based on above numbers.

~12,000 F2 (304 orginal F2)
134 individuals with ss at one marker and ns at the other marker.were grown for phenotype.

Then the attached document, at the bottom of the first page column 2, there is some information that may help.

I don't understand how to set up the recombination frequency problem

Do I divide 134 by 12,000 and then times 100% ?

Please help me.

Thank you.

Sincerely,

Pam

View Full Posting Details