Explore BrainMass
Share

Explore BrainMass

    Single Substitution Polymorphism

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    5'tggtggtggaggctggggtcaaggtggtagccacagtcagtggaacaagcccagtaagccaaaaccaacaygaagcatgtggcaggagctgctgcagctggagcagtggtagggggccttggtggctacat3'

    Can this sequence be cut by a restriction enzyme?

    Can the fragments and coupled with electrophoresis be used to find a single substitution polymorphism?

    © BrainMass Inc. brainmass.com October 10, 2019, 3:59 am ad1c9bdddf
    https://brainmass.com/biology/genetics/single-substitution-polymorphism-444437

    Solution Preview

    The sequence you mentioned can be cut by a number of restriction enzymes (REs). I find this tool to be very helpful in picking REs: http://tools.neb.com/REBsites/index.php

    You basically paste in your sequence and it will tell you the different REs and can generate a virtual gel electrophoresis. In your case there are 49 different REs that can digest your sequence ...

    Solution Summary

    Find an appropriate restriction enzyme that will cut the given sequence. The solution details how you would go about finding the restriction enzyme. The solution then tells you how, armed with that information how you can go about finding a single substitution polymorphism within that DNA sequence. Some background is provided to explain the answer and help you answer similar questions.

    $2.19