Purchase Solution

Single Substitution Polymorphism

Not what you're looking for?

Ask Custom Question

5'tggtggtggaggctggggtcaaggtggtagccacagtcagtggaacaagcccagtaagccaaaaccaacaygaagcatgtggcaggagctgctgcagctggagcagtggtagggggccttggtggctacat3'

Can this sequence be cut by a restriction enzyme?

Can the fragments and coupled with electrophoresis be used to find a single substitution polymorphism?

Purchase this Solution
Solution Summary

Find an appropriate restriction enzyme that will cut the given sequence. The solution details how you would go about finding the restriction enzyme. The solution then tells you how, armed with that information how you can go about finding a single substitution polymorphism within that DNA sequence. Some background is provided to explain the answer and help you answer similar questions.

Solution Preview

The sequence you mentioned can be cut by a number of restriction enzymes (REs). I find this tool to be very helpful in picking REs: http://tools.neb.com/REBsites/index.php

You basically paste in your sequence and it will tell you the different REs and can generate a virtual gel electrophoresis. In your case there are 49 different REs that can digest your sequence ...

Purchase this Solution
Free BrainMass Quizzes
Hemophilia: Fact or Fiction

Do you know the truth about hemophilia? Test your knowledge here.

Basic Concepts in Neuroscience

This quiz provides a review of the basic concepts in neuroscience.

Breastfeeding Basics

How much do you know about breastfeeding? Find out with this quiz!

The Plant Body

This quiz will test your knowledge of the anatomy of a common plant.

BioChemistry Basics

This Quiz will test your knowledge of the amino acids used in biological systems

View More Free Quizzes
Related BrainMass Solutions

  • Polymorphism in bird populations

    Due to the redundancy built into the genetic code even a single-base pair substitution may not necessarily result in an amino acid substitution (ie. serine is encoded by UCX meaning UCU, UCA, UCC, UCG= serine).

  • RFLPs, VNTR, SNP - definitions and use

    This solution explains what is meant by restriction fragment length polymorphism (RFLP), variable number tandem repeat (VNTR), and single nucleotide polymorphism (SNP) analysis. It also details the relationships between them and how they are used.

  • Predicting the inheritance of an X-linked trait

    She will either be a carrier (3.5 Kb and 1.5 Kb) receiving the affected X polymorphism from her mother and the unaffected X polymorphism from her father.

  • Object Oriented Software Development

    The final concept, polymorphism, is the trickiest. Polymorphism is the idea of referring to one object while using a reference to an object of a different type in the inheritance tree. Consider an object type Shape.

  • Balanced polymorphism

    List other examples of balanced polymorphism. 9. Identify a population group with a high prevalence of sickle cell disease other than Africans. 10.

  • Antigen processing and presentation diversity mechanism.

    Polymorphism means that there is variability at the gene locus or again, that there is more than one allele for a given gene.

  • Effect of nucleotide substitution mutation on protein

    252801 Effect of nucleotide substitution mutation on protein Will a change in a single DNA nucleotide (a nucleotide substitution mutation) always result in a changed protein? Why or why not?

  • Dobzhansky's Experiments and Natural Selection

    Polymorphism is a homeostatic device by which populations can persist despite fluctuation in environment. The maintenance of balanced polymorphism in a population is also contingent upon environmental variability.

  • Recognizing types of organic reactions. Attachments in Word.

    A --> B + C SUBSTITUTION or DOUBLE DISPLACEMENT REACTIONS When two reactants exchange components to give two new products.

View More Related Solutions