Cell and Molecular Biology

Cell and molecular biology is an integrative field of study which is focused on understanding the life of a cell. Eukaryotic organisms are composed of a multitude of cells and it is these cells which give rise to all required biological functions, are capable of regenerating and can become mutated.

Molecular biology is a field of study which is closely associated with genetics and aims to understand the processes which occur between cells, proteins and DNA. In essence, molecular biology allows scientists to better comprehend how organisms function and advancements which have been made can be useful to many other fields of science such as biochemistry and genetics.

Over the decades molecular biology has become a wildly popular field and numerous techniques have been developed. Some molecular techniques include the Polymerase Chain Reaction (PCR) which allows for single strands of DNA to be copied or altered and different types of gel electrophoresis, which allow DNA, RNA and proteins to be separated, identified and studied. For instance, southern blotting is a type of gel electrophoresis used to detect specific DNA sequences. 

Cell biology focuses more on understanding the components of a cell, cellular process and how cells become specialized. The internal space of a cell is rather intricate and composed of numerous organelles which ensure that a cell functions properly. In terms of cellular processes, this includes mechanisms such as cellular division and DNA replication. Using molecular techniques, the secrets of a cell can be uncovered. 

Cell and molecular biology is an important and multi-dimensional field in biology which has grown tremendously. Continuous advancements in this field are crucial to shed further insight on the cellular machinery and mechanisms which control all organisms. 

Categories within Cell and Molecular Biology

The Cell Cycle

Postings: 66

The cell cycle, which occurs in both eukaryotes and prokaryotes, is a process which allows for a cell to be duplicated.

Cell Differentiation

Postings: 40

Cell differentiation is a crucial and continuous process in multicellular organisms which allows for cell specialization.

Integrin and Extracellular matrix

You must answer the questions. 600 words each question. . Use diagrams to illustrate with the explanation? . The questions are all essay- type. read them carefully and make sure you answer the question posed. 1. Discuss the structure and function of integrins using diagrams to illustrate your answer 2. 'Extracellular matr

Steps in Isolating DNA Using Strawberry Fruit

To do molecular biology studies of DNA, one must develop methods to extract it. The extraction of DNA can be very complicated because of the structural and chemical complexity of cells. Eukaryotic cells are composed of many different organelles that are suspended in a complex aqueous matrix of soluble and insoluble materials. P

Digestion Assay

Based on the following information how do I solve for 10x buffer, uls HOH, ul Enzyme, and Total? Setup a digest that contains 10 ug of DNA/Sample, 3.5 ug/ul stock DNA (from experiment with 5ul of stock diluted with 995 H2O), 40 units of HAE III enzyme, and enzyme stock of 12 units/ul. Sample ul DNA uls 10x

Biological engineering and chloroplasts

Could cell, tissue, or genetic engineering allow humans to use chloroplasts this way? Describe 1 or 2 factors that would need to be considered for chloroplasts to function in an animal or a human.

Cell Structures Related to the Functions that are Important to life

Choose 1 organelle, and use an analogy to explain its function. For example, explain how a chloroplast is like a solar panel, or how a mitochondrion is like a furnace. Try to think of original analogies for other organelles or cell structures such as golgi, lysosomes, the cell wall, cell membrane, endoplasmic reticulum, ribosome

SLP Natural Selection and Ecology

For each of the SLP assignments, you will be provided with a hypothetical experimental scenario or data. These assignments are more opened-ended than the case assignments. You will speculate about possible explanations and the ways they might be tested, but be sure to that your hypotheses are grounded in accepted biological scie

Natural Selection and Ecology

1) Why is the Hardy-Weinberg law useful? 2) Define genetic drift. 2) What factors influence the mutation rate of a population? 3) Briefly explain the difference between stabilizing selection, directional selection, and disruptive selection. 4) Why are layers of sedimentary rocks particularly useful for geochronology?

DNA microarray

You perform DNA microarray experiments on cancer cells at different time points (0, 6, and 12 hours) following the addition of a novel anti-cancer drug. You obtain the following normalized and scaled microarray data for the genes Myc, p53, and Ras. Gene Name 0 hr 6 hr 12 hr Myc 1.0

Lac Operon Turned Off

Explain how the lac operon is turned off in the absence of lactose. Explain the state of the lac operon when bacteria are in media with both glucose and lactose.

PCR

Explain how PCR has revolutionized recombinant DNA technology.

Needleman-Wuncsh Dynamic Programming Method

Using the document attached, use the Needleman-Wunsch dynamic programming method to align the following pair of sequences. (see attached) Use the unitary scoring method to score the initial alignment matrix. Write the appropriate score into each square in the matrix below. (see attached) Use the Needleman-Wunsch dynami

Matrix Values

Here's a matrix value practice problem for writing sequence patterns.

Cell Biology-Data Interpretation Scrap 6

Please see the attachment for Table 1. Dissolved oxygen is oxygen that is trapped in a fluid, such as water. Since virtually every living organism requires oxygen to survive, it is a necessary component of water systems such as streams, lakes and rivers in order to support aquatic life. The dissolved oxygen is measured in uni

Cellular Morphology

See the attachment and answer the following: Determine the surface area and volume ratio for the three cubes. Which one if the most efficient in cellular morphology?

Categorize things within a multicellular organism

I was asked to categorize items into one of four spaces: - inside the body, outside the epithelium - inside the epithelium, outside of cells - inside cells, out the cytoplasm - inside cells, inside the cytoplasm The items were: - inside stomach - inside cell nucleus - inside bladder - inside endoplasmic reticulum -

Variation in Cells and Receptors

Hi, I need assistance with the following biology questions: 1. Distinguish between tonic and phasic receptors? Which type is likely to be a fast-adapting receptor? Which type is likely to be a slow-adapting receptor? 2.Why are the ependymal cells so important in the formation and circulation of CSF?

Endospores

1. What enviornmental conditions might trigger endospore formation? 2. Why do stained endospores apperar different from vegetative cells?

stem cell research

Stem Cell Research Write two paragraphs or less which describe your current position on stem cell research. In your paper discuss why you hold that view. Describe the circumstances, if any, under which you might reconsider your position. Conduct your own search on President Obama's views of stem cell research. Write a one-pag

Flow cytometer

Explain how this technique was and how it was applied to solve a biological question. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3312548/?tool=pubmed Besides labeling and identifying cells by their surface markers, what ate 2 other applications of flow cytometer techniques.

Factor V Leiden

A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-

Oncogens

Need an explanation regarding oncogens.

Cell Metabolism

A. When the concentration of sugar is doubled, assuming there is enough yeast, what happens to the time it takes for the solution to change from blue to yellow? â?¨ 1. halved 2. â?¨stays the same 3. â?¨doubles 4. â?¨triples B. A test tube is setup with some yeast, sugar solution and indicator in it. The color