Explore BrainMass

Explore BrainMass

    Cell and Molecular Biology

    Cell and molecular biology is an integrative field of study which is focused on understanding the life of a cell. Eukaryotic organisms are composed of a multitude of cells and it is these cells which give rise to all required biological functions, are capable of regenerating and can become mutated.

    Molecular biology is a field of study which is closely associated with genetics and aims to understand the processes which occur between cells, proteins and DNA. In essence, molecular biology allows scientists to better comprehend how organisms function and advancements which have been made can be useful to many other fields of science such as biochemistry and genetics.

    Over the decades molecular biology has become a wildly popular field and numerous techniques have been developed. Some molecular techniques include the Polymerase Chain Reaction (PCR) which allows for single strands of DNA to be copied or altered and different types of gel electrophoresis, which allow DNA, RNA and proteins to be separated, identified and studied. For instance, southern blotting is a type of gel electrophoresis used to detect specific DNA sequences. 

    Cell biology focuses more on understanding the components of a cell, cellular process and how cells become specialized. The internal space of a cell is rather intricate and composed of numerous organelles which ensure that a cell functions properly. In terms of cellular processes, this includes mechanisms such as cellular division and DNA replication. Using molecular techniques, the secrets of a cell can be uncovered. 

    Cell and molecular biology is an important and multi-dimensional field in biology which has grown tremendously. Continuous advancements in this field are crucial to shed further insight on the cellular machinery and mechanisms which control all organisms. 

    © BrainMass Inc. brainmass.com June 23, 2026, 7:05 am ad1c9bdddf

    BrainMass Categories within Cell and Molecular Biology

    The Cell Cycle

    Solutions: 59

    The cell cycle, which occurs in both eukaryotes and prokaryotes, is a process which allows for a cell to be duplicated.

    Cell Differentiation

    Solutions: 39

    Cell differentiation is a crucial and continuous process in multicellular organisms which allows for cell specialization.

    BrainMass Solutions Available for Instant Download

    Opinion of Stem Cell Research

    1. What is your opinion on stem cell research and the use of stem cells in bioengineering? Find an article that supports your opinion. Post the URL of the site where you found the article, along with a brief summary of it. 2. Do you feel the amount of money spent on stem cell research is appropriate or could this money be mo

    Bonding Properties of Water

    The bonding properties of water give it certain characteristics: surface tension, capillary action, universal solvent, high specific heat, and a high heat of vaporization. Indicate three reasons why you believe these properties are important to organisms that live underwater. In your own words, explain one of the following every

    Mass Spectrometry Predicting Protein Sequences

    This assignment focuses on the methodology of peptide mass finger printing (PMF) and use of mass spectrum analysis software. The lecture notes provide a good foundation for this but you will have to carry out additional personal research to effectively answer the questions. The learning objective of the assignment is to give you

    Gene Expression and Application

    Answer the following questions about DNA microarrays and gene expression analysis a. Why aren't all genes expressed all the time? b. What is the advantage of using DNA arrays vs. one gene at a time analysis? c. What is the significance of co-regulated genes? d. What is the significance of a condition specific gene expression

    Lambda Phage and Biotechnology

    Discuss lambda phage as an experimental system. How has it been used in biotechnology? Explain how it is used as a vector for the cloning of recombinant DNA. Why is it important to know about restriction enzyme sites in phage lambda DNA? How would a scientist use a restriction site map for lambda?

    Effects of Irradiation of Fetus

    An x-ray exam has been performed on a female who later determined she was pregnant at the time of the x-ray exposure. Discuss the factors that affect her embryo's response to irradiation. Explain the possible principal effects of irradiation to her fetus. Design a graph/table showing specific effects on various organs of th

    Integrin and Extracellular matrix

    You must answer the questions. 600 words each question. . Use diagrams to illustrate with the explanation? . The questions are all essay- type. read them carefully and make sure you answer the question posed. 1. Discuss the structure and function of integrins using diagrams to illustrate your answer 2. 'Extracellular matr

    Steps in Isolating DNA Using Strawberry Fruit

    To do molecular biology studies of DNA, one must develop methods to extract it. The extraction of DNA can be very complicated because of the structural and chemical complexity of cells. Eukaryotic cells are composed of many different organelles that are suspended in a complex aqueous matrix of soluble and insoluble materials. P

    Biological engineering and chloroplasts

    Could cell, tissue, or genetic engineering allow humans to use chloroplasts this way? Describe 1 or 2 factors that would need to be considered for chloroplasts to function in an animal or a human.

    Cell Structures Related to the Functions that are Important to life

    Choose 1 organelle, and use an analogy to explain its function. For example, explain how a chloroplast is like a solar panel, or how a mitochondrion is like a furnace. Try to think of original analogies for other organelles or cell structures such as golgi, lysosomes, the cell wall, cell membrane, endoplasmic reticulum, ribosome

    SLP Natural Selection and Ecology

    For each of the SLP assignments, you will be provided with a hypothetical experimental scenario or data. These assignments are more opened-ended than the case assignments. You will speculate about possible explanations and the ways they might be tested, but be sure to that your hypotheses are grounded in accepted biological scie

    Natural Selection and Ecology

    1) Why is the Hardy-Weinberg law useful? 2) Define genetic drift. 2) What factors influence the mutation rate of a population? 3) Briefly explain the difference between stabilizing selection, directional selection, and disruptive selection. 4) Why are layers of sedimentary rocks particularly useful for geochronology?

    DNA microarray

    You perform DNA microarray experiments on cancer cells at different time points (0, 6, and 12 hours) following the addition of a novel anti-cancer drug. You obtain the following normalized and scaled microarray data for the genes Myc, p53, and Ras. Gene Name 0 hr 6 hr 12 hr Myc 1.0

    Needleman-Wuncsh Dynamic Programming Method

    Using the document attached, use the Needleman-Wunsch dynamic programming method to align the following pair of sequences. (see attached) Use the unitary scoring method to score the initial alignment matrix. Write the appropriate score into each square in the matrix below. (see attached) Use the Needleman-Wunsch dynami

    Cell Biology-Data Interpretation Scrap 6

    Please see the attachment for Table 1. Dissolved oxygen is oxygen that is trapped in a fluid, such as water. Since virtually every living organism requires oxygen to survive, it is a necessary component of water systems such as streams, lakes and rivers in order to support aquatic life. The dissolved oxygen is measured in uni

    Variation in Cells and Receptors

    Hi, I need assistance with the following biology questions: 1. Distinguish between tonic and phasic receptors? Which type is likely to be a fast-adapting receptor? Which type is likely to be a slow-adapting receptor? 2.Why are the ependymal cells so important in the formation and circulation of CSF?

    stem cell research and political views of President Obama

    Stem Cell Research Write two paragraphs or less which describe your current position on stem cell research. In your paper discuss why you hold that view. Describe the circumstances, if any, under which you might reconsider your position. Conduct your own search on President Obama's views of stem cell research. Write a one-pag

    Genetic Fingerprinting

    What is genetic fingerprinting? Should all children be genetically finger printed at birth? If so, who should control the information obtained and who should have access to the information? What are the advantages, disadvantages, and potential problems associated with this proposal?

    Flow cytometer

    Explain how this technique was and how it was applied to solve a biological question. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3312548/?tool=pubmed Besides labeling and identifying cells by their surface markers, what ate 2 other applications of flow cytometer techniques.

    Primer explanation for Factor V Leiden

    A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-

    Oncogenes

    Please provide an explanation for the role of oncogenes.

    Cell Biology Comparisons

    2. The inner membranes of cyanobacteria are very similar to those of the thylakoid membrane of chloroplasts. This similarity supports the hypothesis that chloroplasts evolved from symbiotic cyanobacteria. Which other organelles may have originated in the same way? Explain, providing evidence for your choice. 4. Proviruses can

    Cell Metabolism

    A. When the concentration of sugar is doubled, assuming there is enough yeast, what happens to the time it takes for the solution to change from blue to yellow? â?¨ 1. halved 2. â?¨stays the same 3. â?¨doubles 4. â?¨triples B. A test tube is setup with some yeast, sugar solution and indicator in it. The color

    Growth of a Tumor

    We now understand that mutations that cause the inhibition of apoptosis are found in tumors. Because proliferation itself is not induced by the inhibition of apoptosis, explain how this inhibition might contribute to tumor formation.

    Synthesis After Replication

    Propose an experiment to distinguish between semi-conservative, conservative, and dispersive synthesis after a single round of replication.