Share
Explore BrainMass

Cell and Molecular Biology

Specialized Functions of Epithelial Coverings

Original question is: Which of the following is not a specialized function of epithelial coverings? a. the exchange of gases b. the secretion of lubricants c. the release of odorous secretions d. the facilitation of flexibility for movement e. the excretion of wastes

The Mobility of Proteins on Electorphoresis Gels

Attached is a graph showing the relationship between migration distance and the log of the protein molecular weight. There follow questions relating to how the graph would look at higher or lower agarose concentrations. Lastly the whether the proteins migrate towards the cathode or anode is addressed, and the reasons for this

Membranes

Given the composition of the fictitious membranes below, which membrane is the most fluid? a. 50% saturated fatty acid and 50% unsaturated fatty acid b. 70% saturated fatty acid and 30% unsaturated fatty acid c. 30% saturated fatty acid and 70% unsaturated fatty acid e. 80% saturated fatty acid and 20% unsaturated fatty ac

Genome Project

1. Locate the chromosomal map position of the BRCA1 gene and identify the genes located nearby. 2. Obtain the exon / intron structure of the BRCA1 gene. 3. What are the common mutations in BRCA! gene? 4. Find the single nucleotide polymorphisms (SNP) within this gene. 5. Design PCR primers for an exon of the gene using a pr

Alpha Helix Calculations in Bacteriorhodopsin

Under some environmental conditions the halophile Halobacterium halobium synthesizes a membrane protein (MW 26,000) bacteriorhodopsin, which is purple because it contains retinal. Molecules of this protein aggregate into purple patches in the cell membrane. Bacteriorhodopsin acts as a light activated proton pump that provi

Protein Targeting and the lac Operon

1.How are proteins targeted to different compartments with in a eukaryotic cell? Please give a detailed example of how a protein is targeted to a specific organelle. 2.Please describe, in depth, the regulation of the lac operon.

How Lipoproteins Are Secreted to the Outer Membrane

See the attached file. 1. Describe in detail how lipoproteins are secreted to the outer membrane. How is Sec system involved. What part do β-barrels play in the process? How does the process differ for lipoproteins attached to the periplasmic face of the inner membrane and the outer membrane (Figure 1). 2. Describe in deta

DNA is the molecule of heredity

List the scientists and the work they did to convince science and society tht DNA is the molecule of heredity. List the evidence that would convince you that DNA is the molecule of heredity. Reflect on why learning about the history and science of DNA is important in learning that DNA is the molecule of heredity.

Cell Biology

1. Calmodulin a. is an ubiquitous protein in eukaryotic cells b. binds Ca2+ c. is a membrane bound protein d. a and b 2. All of the following properties about nitric oxide are true EXCEPT: a. is a gas b. is synthesized from O2 and arginine c. has a half-life of 2-3 minutes d. activates guanylyl cyclase 3. A

Cell Biology

1. How do evolutionary biologist explain why there are two different ways of handling the pyruvate produced from glycolysis? Be sure to relate your answer to the nature of the Earth 3.5 billion years ago. 2. Explain at a biochemical level how wine is made and compare it to your activity of rapidly opening and closing your ha

Genetic Biology

1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this question, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hir

DNA template strand

A portion of an exon of a eukaryotic protein-coding gene has the following sequence on the template strand: 5'-AGTCAAGCATCCCTTA-3' What is the sequence of the non-template strand written in the 5'-3' orientation? What is the sequence of the corresponding region of the mRNA? , what is the amino acid sequence of the corres

Using DNA in Criminal Behavior

Today, scientific advances are being made at an astounding rate, and nowhere is this more evident than in our understanding of the biology of heredity. Using DNA as a starting point, do you believe there are limits to the knowledge people should acquire? Defend your answer. Because genetics is important to so many aspects of hu

DNA

1. Explain the process that DNA replicates by. Why is it so important that it is carried out in this matter? In explaining the actual process, refer to the possible choices that the scientist considered: conservative, semi-conservative and dispersive. 2. Speciation is a concept that mean one species becoming 2 or more by a pr

Chromosone

A male who has an allele for HD (Huntingtons Disease) mates with a woman who is phenotypically normal. What proportion of thier children will carry the trait (meaning have it but not show the symptons at any time in their life) and what proportion of their children will actually have the disease along with the trait? Some fam

Mendelian Dominant Recessive Traits

Hair color, eye color and widows peak are all Mendelian dominant recessive traits. If a couple who is heterozygous (both of them mind you) for each of the three traits what are the odds that they will have a child that has dark hair (Dom), Blue Eyes (Rec) and a widows peak (Dom). I think the answer should be a fraction with the

Chromosomes

Two normal parents have 3 children, one a normal girl, one a normal boy and the other boy with hemophilia. If the affected son marries a girl whose father also had hemophilia, what are the overall chances of having a hemophiliac child? A male from India carries an odd trait for hairy ears that is based on the Y chromosome. As

Restriction endonucleases

There are four questions to be answered: 1. What type of amino acid side chains would you expect to find folded on the interior of a globular protein? What kind of experimental evidence supports this claim? 2. Which amino acid lacks a stereoisomer and which has more than one asymmetric carbon? 3. What property of th

Genetics

How come we age and die while the genome is immortal? What is telomerase?

Bacterial mRNA

This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene. AUGUUUGCUGGGGGACAUUCGUGGGCA from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed

Molecular Biology (Nucleic Acids and the Genetic Material) Multiple Choice

1. Which scientists first gave experimental evidence that DNA is the genetic material? A Avery, MacLeod, and McCarty who repeated the transformation experiments of Griffith, and chemically characterized the transforming principle. B Garrod, who postulated that Alcaptonuria, or black urine disease, was due to a defective enz

Various Types of Microscopes and Their Uses

What type of microscope (Dissecting Microscope, Compound Light Microscope, TEM or SEM) you would use to examine the following specimens and explain WHY the choice of microscope is appropriate: a) human tooth b) human blood cell: c) mitochondrial membrane folding d) pollen grain surface structure

Part of the lab final

I cant figure out what i am suppose to do for this assignement that we are to do. it says to apply each lab that we have done in the class to our career . for example the lab on osmossis and diffusion how would i make three applications for that lab?