Purchase Solution

Bacterial mRNA

Not what you're looking for?

Ask Custom Question

This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene.
AUGUUUGCUGGGGGACAUUCGUGGGCA
from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

Determine the sequence of amino acids coded for by this mRNA

I have done this question I am hoping my answer will match yours. Many thanks

Purchase this Solution

Solution Preview

Posting # 22113
<br>
<br>Sandie:
<br>
<br>As you are aware, bacterial messenger RNA is not spliced, thus the mRNA will begin with a methionine codon (AUG, which you have identifed at the left or 5-prime end of the sequence) and the mRNA will represent exactly the sequence of the plus strand of the bacterial gene (with the U- uracil in RNA replaced by T- thymine in the DNA). The classic base pairing rules are simple- guanine pairs with cytosine (G:C), and uracil/thymine pairs with adenine (U/T:A). Using these rules, the first part of your question is easily answered:
<br>
<br> ...

Purchase this Solution


Free BrainMass Quizzes
Feeding Babies

Do you know the science behind feeding babies? Test your knowledge with this quiz.

Comfort Measures For Labor

Are you ready to doula someone through labor?

How Much Do You Know About Genetic Inheritance?

Most of us studied the basics of dominant and recessive genes at some point. However, genetics are much more complicated than this. How far beyond the basics does your knowledge go?

Biochemistry Basics

A refresher quiz to test your knowledge of basics concepts of biochemistry.

Creating a Birth Plan

Preparing for a birth and want to make sure that you're including all the right information? Use this quiz to get on the right track and check your birth plan knowledge!