Purchase Solution

Bacterial mRNA

Not what you're looking for?

Ask Custom Question

This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene.
AUGUUUGCUGGGGGACAUUCGUGGGCA
from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

Determine the sequence of amino acids coded for by this mRNA

I have done this question I am hoping my answer will match yours. Many thanks

Purchase this Solution
Solution Preview

Posting # 22113
<br>
<br>Sandie:
<br>
<br>As you are aware, bacterial messenger RNA is not spliced, thus the mRNA will begin with a methionine codon (AUG, which you have identifed at the left or 5-prime end of the sequence) and the mRNA will represent exactly the sequence of the plus strand of the bacterial gene (with the U- uracil in RNA replaced by T- thymine in the DNA). The classic base pairing rules are simple- guanine pairs with cytosine (G:C), and uracil/thymine pairs with adenine (U/T:A). Using these rules, the first part of your question is easily answered:
<br>
<br> ...

Purchase this Solution
Free BrainMass Quizzes
Feeding Babies

Do you know the science behind feeding babies? Test your knowledge with this quiz.

Comfort Measures For Labor

Are you ready to doula someone through labor?

How Much Do You Know About Genetic Inheritance?

Most of us studied the basics of dominant and recessive genes at some point. However, genetics are much more complicated than this. How far beyond the basics does your knowledge go?

Biochemistry Basics

A refresher quiz to test your knowledge of basics concepts of biochemistry.

Creating a Birth Plan

Preparing for a birth and want to make sure that you're including all the right information? Use this quiz to get on the right track and check your birth plan knowledge!

View More Free Quizzes
Related BrainMass Solutions

  • The promoters for mRNA encoding early proteins in viruses like T4 have a different sequence

    181653 The promoters for mRNA encoding early proteins in viruses like T4 have a different sequence The promoters for mRNA encoding early proteins in viruses like T4 have a different sequence than the promoters for mRNA encoding late proteins in the same

  • Human Biology - mRNA

    44726 Human Biology - mRNA This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene.

  • Transcription of mRNA can be Terminated in Prokaryotic Cells

    of foreign gene in bacterial cell.

  • DNA cloning

    Bacteria are unable to process introns therefore in order to express alpha-globin in a bacterial cell the introns must be removed to create cDNA (compliment DNA which is a DNA copy of the mRNA). 2.

  • bacteriophages and lysogeny

    Single stranded RNA viruses can be further divided into those with positive sense RNA (that can act as mRNA in a cell) and those with negative sense RNA (which needs to be copied into a complementary copy to act as mRNA).

  • Gene Cloning, Manipulation, & Applications

    -reverse transcript your mRNA pool to create cDNA. -PCR amplify your cDNA of interest from your cDNA pool and insert it into a bacterial vector.

  • Creating a Recombinant Microorganism

    Specifically, bacterial DNA is often held in circular rings called plasmids, which can be enzymatically cleaved apart, leaving two ends from which foreign DNA can then bind.

  • Molecular Genetics of Prokaryotes

    Only 1, the lac Z- allele on the bacterial chromosome. B. Only 1, the lac Z+ allele on the bacterial chromosome. C. Two, the lac Z- allele on the bacterial chromosome and the lac Z+ allele on the bacterial chromosome.

  • DNA Synthesis and RNA Transcription

    Prokaryotic or bacterial has one replicon. One replication bubble is formed during DNA replication. Initiation of DNA replication in prokaryotes is carried out by protein DnaA and DnaB.

View More Related Solutions