Explore BrainMass
Share

Explore BrainMass

    Bacterial mRNA

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene.
    AUGUUUGCUGGGGGACAUUCGUGGGCA
    from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

    Determine the sequence of amino acids coded for by this mRNA

    I have done this question I am hoping my answer will match yours. Many thanks

    © BrainMass Inc. brainmass.com October 9, 2019, 4:05 pm ad1c9bdddf
    https://brainmass.com/biology/cell-and-molecular-biology/bacterial-mrna-22113

    Solution Preview

    Posting # 22113
    <br>
    <br>Sandie:
    <br>
    <br>As you are aware, bacterial messenger RNA is not spliced, thus the mRNA will begin with a methionine codon (AUG, which you have identifed at the left or 5-prime end of the sequence) and the mRNA will represent exactly the sequence of the plus strand of the bacterial gene (with the U- uracil in RNA replaced by T- thymine in the DNA). The classic base pairing rules are simple- guanine pairs with cytosine (G:C), and uracil/thymine pairs with adenine (U/T:A). Using these rules, the first part of your question is easily answered:
    <br>
    <br> ...

    $2.19