Explore BrainMass
Share

Explore BrainMass

    Human Biology - mRNA

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene.
    AUGUUUGCUGGGGGACAUUCGUGGGCA
    from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

    Determine the sequence of amino acids coded for by this mRNA.

    © BrainMass Inc. brainmass.com October 9, 2019, 4:58 pm ad1c9bdddf
    https://brainmass.com/biology/dna-chromosomes-and-genomes/human-biology-mrna-44726

    Solution Summary

    The solution discusses mRNA sequence in the subject of human biology.

    $2.19