Purchase Solution

Human Biology - mRNA

Not what you're looking for?

Ask Custom Question

This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene.
AUGUUUGCUGGGGGACAUUCGUGGGCA
from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

Determine the sequence of amino acids coded for by this mRNA.

Purchase this Solution
Solution Summary

The solution discusses mRNA sequence in the subject of human biology.

Purchase this Solution
Free BrainMass Quizzes
BIOLOGY

Basics in biology

Comfort Measures For Labor

Are you ready to doula someone through labor?

Identifying Variables in Science Experiments, Part 2

Using sample experiments, test yourself to see if you can identify independent, dependent, and controlled variables. Identifying variables is key in understanding and developing experiments. The questions are biology related, but this can be applied to any area of science.

Infant Development: Sleep

How much do you know about infant sleep? Test your knowledge with this quiz.

Nerves and the Nervous System

This quiz will assess your knowledge of the nervous system and how nerves send signals around the body.

View More Free Quizzes
Related BrainMass Solutions

  • DNA strand

    The graphical representation of the double helix structure of DNA is from Molecular Biology of the Cell, 3rd edition, Alberts et al., 1994 The mRNA molecule will represent exactly the sequence of the plus strand of the gene (with the U- uracil in RNA

  • Essay about DNA, mRNA, translation

    Source for information: Molecular Cell Biology (4th edition) - Harvey Lodish, Arnold Berk, S.

  • Molecular Biology Questions

    474584 Molecular Biology Questions TRUE "or" FALSE Questions 1. mRNA degradation pathways in bacteria are the same as in eukaryotic cells. 2. Trans splicing relations involve small snoRNAs. 3.

  • Molecular Biology of the Gene

    By the above information, you should see that mRNA, rRNA and tRNA are all processed. The only exception is the rRNA known as 5S rRNA. The solution discusses the molecular biology of the gene.

  • How is mRNA formed from DNA?

    After capping, tailing, and splicing, the molecule is considered a mature mRNA. Source: Campbell's Biology 5th edition This solution explain the process (transcription) in which mRNA is derived out of DNA.

  • The Difference between Eukkaryotic and Prokaryotic mRNA

    In the previous solution (Cell Biology QuestionsIII) which describes the lac operon, all three structural genes (lacZ, lacY, lacA) are transcribed into a single mRNA transcript.

  • Exploring Gene Expression, Population Evolution and DNA Technology

    Describe how different organisms are used to mass-produce proteins of human interest. D. Describe how forensic DNA profiling works. Biology Questions Question 1 A.

  • Bacterial mRNA

    Code

    The National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/ ) has many excellent molecular biology and genetics resources, as does the Fact Index (http://www.fact-index.com/index.html) From Wikipedia.

  • Human beta-globin polypeptide

    135894 Human beta-globin polypeptide The human beta-globin polypeptide is 146 amino acids long. How long is the coding portion of the human beta-globin mRNA? Each amino acid is coded for by three nucleotides (called a "codon") found in mRNA.

View More Related Solutions