Purchase Solution

DNA strand

Not what you're looking for?

Ask Custom Question

Working in a research lab, a colleague has identified an mRNA strand that can be translated into a particular protein.
Your job is to decode the DNA that would be transcribed to form the mRNA strand in question. Given the mRNA strand below, label the sense and anti-sense strands of the DNA you decode. EXPLAIN the observations and the inferences that help to decide which strand is which.

A U G U A U G A G A A U C C C C G G U A A

This job is decoded.

Purchase this Solution
Solution Summary

Help with a DNA strand is given.

Solution Preview

Discussion:

The messenger RNA (mRNA) is transcribed from the DNA template by an RNA transcriptase. As you are aware, DNA is comprised of two helical strands linked together by the hydrogen bonds between the nucleoside bases attached to the phosphate backbone. See figure 1:

Figure 1. The familiar Rosalind Franklin, James Watson, Francis Crick and Maurice Wilkins model of the DNA molecule (all but Dr. Franklin received the Nobel Prize in 1962 for this work). The graphical representation of the double helix structure of DNA is from Molecular Biology of the Cell, 3rd edition, Alberts et al., 1994

The mRNA molecule will represent exactly the sequence of the plus strand of the gene (with the U- uracil in RNA replaced by T- thymine in the DNA), if ...

Purchase this Solution
Free BrainMass Quizzes
Basic Concepts in Neuroscience

This quiz provides a review of the basic concepts in neuroscience.

Cellular Respiration

This quiz is a review for cellular respiration.

Breastfeeding Basics

How much do you know about breastfeeding? Find out with this quiz!

BIOLOGY

Basics in biology

The Heart

This quiz test the understanding of the heart and some of its parts. It is important to understand how the heart functions and what makes it function.

View More Free Quizzes
Related BrainMass Solutions

  • DNA Synthesis

    The two DNA strand are antiparallel because one strand have the 5'---> 3' orientation, whereas the other strand have the 3'-----> 5' orientation. Step 3: After DNA polymerase reaches the end of the template strand, it stop replication.

  • Complimentary base paring in DNA

    Unwinding of DNA chain by enzyme helicase 2. Priming by Primase in which small segment of RNA is formed on the DNA strand 3. Complimentary base pairing occurs and new strand of DNA is formed. This step is ctalyzes by enzyme DNA polymerase III.

  • lambda phage genome insertion

    C Double strand cleavage of the cellular DNA target site, followed by double-strand break repair, using the viral DNA as the donor. D blunt-ended double-strand breakage in both DNAs, followed by rejoining with no heteroduplex formation.

  • Nucleic Acids and the Genetic Material

    In this diagram of the process of DNA replication at a replication fork, the newly synthesized DNA strand labeled C is the: A coding strand B parental DNA C leading strand D lagging strand 5.

  • DNA Transcription & Replication

    That means that the NEW strand being synthesized is going from the 5 prime end to the 3 prime end. Therefore, on the template strand of DNA, THAT strand is going 3 prime to 5 prime.

  • Discuss different models for DNA replication that were considered by early researchers.

    For example, if the DNA polymerase reads Adenine on the parental strand, it will add a thymine in the daughter strand. DNA polymerase catalyzes replication in both directions from the replication origin.

  • DNA replication

    a DNA molecule consists of one parental strand and one new strand c. the number of DNA molecules is doulbed with every other replication d. the replication of DNA never takes place with 100% accuracy e.

  • Sequencing of DNA or RNA

    108279 Sequencing of DNA or RNA Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following: i) Is this a strand of DNA or RNA? How do you know? ii) If DNA, what is the complementary strand?

  • Two strands of a DNA molecule are radio-labeled such that each strand can be uniquely identified.

    155703 Two strands of a DNA molecule are radio-labeled such that each strand can be uniquely identified. Two strands of a DNA molecule are radio-labeled such that each strand can be uniquely identified.

View More Related Solutions