Purchase Solution

Sequencing of DNA or RNA

Not what you're looking for?

Ask Custom Question

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Purchase this Solution
Solution Summary

In about 450 words, the concepts of DNA, mRNA and coding are explored. This solution clearly explains how to derive the coding sequences from the given single strand of nucleic acid in this scenario and the implications of modifications to this strand.

Solution Preview

DNA, mRNA and the Genetic Code

We have the following single strand of nucleic acid:

5'- ATGCTATCATTGACCTTGAGTTATTAA -3'

i) Is this a strand of DNA or RNA? How do you know?

Response: We know it is DNA because it is made up of the four bases that exist in DNA: AGCT. On the other hand, RNA has AGCU. Uracil replaces thymine in RNA.

ii) If DNA, what is the complementary strand?

Response: The complementary strand will run in an antiparallel fashion and will base pair according to the following rule: GC and AT.

Therefore, the complementary strand is:

3'- TACGATAGTAACTGGAACTCAATAATT -5'

iii) If this were the coding strand of a DNA molecule, ...

Purchase this Solution
Free BrainMass Quizzes
Infant Development: Sleep

How much do you know about infant sleep? Test your knowledge with this quiz.

Basic Concepts in Neuroscience

This quiz provides a review of the basic concepts in neuroscience.

Do You Know Your Macromolecules?

This quiz will assess your knowledge of the macromolecules that are important to living things.

Cellular Respiration

This quiz is a review for cellular respiration.

Comfort Measures For Labor

Are you ready to doula someone through labor?

View More Free Quizzes
Related BrainMass Solutions

  • cDNA Libraries and RNA Editing

    The sequences of the original RNA molecules are then reconstructed just as contigs are constructed in shotgun sequencing.

  • Bioinformatics questions

    ----Transcriptomes; ElMMo and CLIPZ CLIPZ is useful for the prediction of binding sites on RNA for RNA-binding proteins.

  • Questions Related to Gene Sequences

    (e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for.

  • Matching structures and major organic products along with Stolle Synthesis

    RNA base sequence with guanine at the 3' end. 3. DNA base sequence with cytosine at the 3' end. 4. uridine 5. a purine nucleoside 6. DNA sequencing method for the human genome 7.

  • yeast and human genes

    Subjecting human DNA to PCR using these primers would then amplify the homologous sequence, which could be used for sequencing, and then compared with the sequence of the yeast gene to determine the exact homology.

  • How is mRNA formed from DNA?

    In addition, the RNA may be spliced, a process in which introns, or noncoding pieces of RNA are removed, and the exons, or coding pieces, are spliced together. After capping, tailing, and splicing, the molecule is considered a mature mRNA.

  • Compare and Contrast DNA and RNA

    This is how DNA and RNA work together in the body. In eukaryotes a gene (encoded by the nucleotides of DNA) usually contains coding sequences or exons, interspersed with non-coding sequences or introns.

  • DNA Technology

    132128 DNA Technology 1. Describe DNA sequencing with reference to the cloning of a DNA fragment in a bacteriophage M13 based cloning vector. 2.

  • DNA, RNA, & Proteins. Who's Walking the Dogma?

    order or to make more of them.

View More Related Solutions