Explore BrainMass

Sequencing of DNA or RNA

This content was STOLEN from BrainMass.com - View the original, and get the solution, here!

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

© BrainMass Inc. brainmass.com September 24, 2018, 1:34 am ad1c9bdddf - https://brainmass.com/biology/sequencing/sequencing-of-dna-or-rna-108279

Solution Preview

DNA, mRNA and the Genetic Code

We have the following single strand of nucleic acid:


i) Is this a strand of DNA or RNA? How do you know?

Response: We know it is DNA because it is made up of the four bases that exist in DNA: AGCT. On the other hand, RNA has AGCU. Uracil replaces thymine in RNA.

ii) If DNA, what is the complementary strand?

Response: The complementary strand will run in an antiparallel fashion and will base pair according to the following rule: GC and AT.

Therefore, the complementary strand is:


iii) If this were the coding strand of a DNA molecule, ...

Solution Summary

In about 450 words, the concepts of DNA, mRNA and coding are explored. This solution clearly explains how to derive the coding sequences from the given single strand of nucleic acid in this scenario and the implications of modifications to this strand.
