Questions Related to Gene Sequences
Not what you're looking for?
The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.
AUGUUUGCUGGGGGACAUUCGUGGGCA
(a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.
(b) Determine the sequence of amino acids coded for by this mRNA.
(c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an example explain how is this possible.
(d) When DNA is replicated, errors in copying may occur, leading to the substitution of one base for another in the DNA sequence. Given two reasons why these errors often have little or no effect on the polypeptide produced in the transcription and translation of that particular DNA sequence.
(e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for. What would be the effect on the final polypeptide produced if the DNA sequence you wrote down in part (a) was changed in the following ways?
i) Insertion of the base T at the beginning of the DNA sequence.
ii) Deletion of the 10th base in the DNA sequence.
In each case write down the new DNA sequence followed by the new mRNA sequence corresponding with this altered DNA.
Explain the possible effect on the polypeptide produced.
(f) Referring to the mRNA sequence taken from the bacteria, it is possible to deduce the exact corresponding DNA sequence of a specific gene. In eukaryotic organisms the relationship between the number of sequence of bases in the mRNA and in the corresponding DNA is not so straightforward. Explain why it is not possible to predict the exact sequence of bases in eukaryotic DNA by examining the corresponding mRNA alone.
Purchase this Solution
Solution Summary
The solution provides a detailed description of the conversion of DNA to RNA to protein. This question is a typical DNA sequencing problem that is often found on exams and tests. The solution solves the problem asked and gives enough detail so that the question adn answer can be used for review and/or practise.
Solution Preview
When deducing a DNA/RNA sequence it is good to write out everything and label your strands with 5' and 3' (so you know the proper orientation). Also, writing everything out completely will help you keep things organized.
A) The non-coding strand has T's (thymine) instead of U's (uracil) and the coding strand is the complement of this strand.
5'-ATGTTTGCTG GGGGACATTC GTGGGCA-3' non-coding
5'-TACAAACGAC CCCCTGTAAG CACCCGT-3' coding strand
5'-AUGUUUGCUG GGGGACAUUC GUGGGCA-3' mRNA transcribed from the coding strand.
B) To determine which amino acid should be placed in the sequence you need to use a ...
Purchase this Solution
Free BrainMass Quizzes
Basic Concepts in Neuroscience
This quiz provides a review of the basic concepts in neuroscience.
Comfort Measures For Labor
Are you ready to doula someone through labor?
Human Anatomy- Reproductive System
Do you know your reproductive anatomy?
Nerves and the Nervous System
This quiz will assess your knowledge of the nervous system and how nerves send signals around the body.
Breastfeeding Basics
How much do you know about breastfeeding? Find out with this quiz!