Explore BrainMass

Explore BrainMass

    Sequencing

    Deoxyribonucleic Acid (DNA) contains genetic information in the form of base sequences of nucleotides that produce amino acids in protein formation. There are four types of bases that are complementarily paired: adenine is paired with thymine by two hydrogen bonds whilst cytosine is paired with guanine by three hydrogen bonds. DNA sequencing is a process that determines the precise base sequence of DNA using various methods. Knowledge on base sequences is integral in the biological sciences in understanding how genotypes affect phenotypes, formation of genetic disorders and fundamental genome information. The first sequence was produced by chromatography in the 1970s, however due to advancements in technology various methods have been developed to determine base sequences quickly and accurately. There are four main types of DNA sequencing: Sanger method, Maxam-Gilbert method, primer walking and shotgun sequencing.

    The Sanger or Dideoxy method uses the Polymerase Chain Reaction (PCR) to produce strands of parent DNA with free nucleotides with dideoxynucleoside triphosphate (ddNTP) attached to the bases. Once a nucleotide with a ddNTP is used in the new strand it is truncated. Upon completion of the PCR, a mixture of differently truncated fragments of parent strand is produced which are then separated by gel electrophoresis. The parent strand sequence can be determined by organizing the lengths of strands.

    The Maxam-Gilbert method uses chemicals to cleave at specific nucleotides where each base can be isolated. The fragments are then radioactively labeled, and undergo gel electrophoresis to be separated. Using x-rays the DNA fragments can be displayed in dark bands, which then base sequence is determined.

    Primer walking uses larger portions of DNA, larger than 800 base pairs, which can be sequenced by using primers in the Sanger method. Shotgun sequencing cuts target DNA portions into small a size, which then is sequenced and arranged by identifying overlapping portions – this method relies heavily on computer analysis and control. 

    © BrainMass Inc. brainmass.com June 21, 2026, 9:01 pm ad1c9bdddf

    BrainMass Solutions Available for Instant Download

    Gel Electrophoresis Mobility: Particle Migration

    Electrophoretic mobility, describes the velocity of a particle moving through a gel matrix under the influence of an electrical field. Given a constant electrical field, what characteristics of the molecule influence its velocity through the matrix? State whether these characteristics enhance or diminish the particle's migration

    DNA Sequencing Methodology: Dideoxy and Pyrosequencing

    I have two questions in biology and I need perfect answer Question 1 Explain the two main methods of sequencing, the dideoxy (Sanger) method and the basic method of 'pyrosequencing' Question 2 Show, with examples, how the 'pyrosequencing' method has been useful for very high throughput applications thank you

    Mouse DNA Sequencing Methods and Explanations

    I have a particular strain of mouse and want to determine the DNA sequence of a specific region of one gene(and here we can assume the DNA to be tested comes from one mouse and is NOT expected to be heterozygous at the locus tested i.e. assume uniform DNA content). I look at the known DNA sequence in that region (for normal mic

    PCR Process

    If the denaturation step of PCR was omitted, what would happen to the PCR process? How is PCR used to determine that a person is infected with a specific bacterium? Now that we have PCR, why would we use culture techniques? If a DNA polymerase other than the polymerase from Thermus aquaticus was used in the PCR proce

    Determining the GC Ratio

    Need some clarification please help. Determine the GC ratio of the following stretch of DNA from 2 different bacteria: Bacterium #1: GCATTAGCCGTATCCGAT CGTAATCGGCATAGGCTA Bacterium #2: CGACCGGCCATGGCGCGT GCTGGCCGGTACCGCGCA What conclusion would you draw about the relatedness of these 2 organisms and why?

    Designing primers for PCR: finding problems with primers

    1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction? 2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well. a) Forward primer 5' GCCTCCGGAGACCCATTGG 3' reverse primer 5' TTCTAAGAAACTGTTAAGG 3' b) Forw

    Polymerase chain reaction

    Mary set up a similar PCR reaction. The Tm of the forward and reverse primers she uses is 55oC. The conditions that were optimized by her instructor were as follows: Cycle Temperature (oC) Time 1X 94o 3 minutes 30X 94o 30 seconds Denaturation 50o 30 seconds Annealing 72o 60 seconds Extension Mary sets u

    Sequencing of DNA or RNA

    Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following: i) Is this a strand of DNA or RNA? How do you know? ii) If DNA, what is the complementary strand? iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be? iv) If this were the non-coding

    The Process of DNA Fingerprinting

    Please describe the process of DNA fingerprinting and explain how DNA fingerprinting can differentiate between possible suspects in a crime.

    New Developments in DNA Sequencing Technology.

    In recent years, molecular biology has undergone a revolution that can be partially attributed to the advent of easy DNA sequencing methods (thanks to Fred Sanger's work published in 1977), and yet the sequencing technology continues to change. Briefly discuss new developments in DNA sequencing technology.