Purchase Solution

Designing primers for PCR: finding problems with primers

Not what you're looking for?

Ask Custom Question

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Purchase this Solution
Solution Summary

Why use a temperature-stable polymerase in PCR reactions is determined. The expert determines what features of PCR primers may cause practical problems in PCR reactions.

Solution Preview

The temperature stable DNA polymerase is needed because this enzyme must survive the high temperature of PCR denaturing cycles. Otherwise fresh enzyme ...

Purchase this Solution
Free BrainMass Quizzes
Breast Milk and Breastfeeding

How much do you know about breast milk and breastfeeding? Double check your knowledge level with this quiz!

Feeding Babies

Do you know the science behind feeding babies? Test your knowledge with this quiz.

Creating a Birth Plan

Preparing for a birth and want to make sure that you're including all the right information? Use this quiz to get on the right track and check your birth plan knowledge!

Light and Sight Vocabulary

This quiz introduces basic definitions of vocabulary related to light and how human eyes. This information is important for an understanding of sight.

The Plant Body

This quiz will test your knowledge of the anatomy of a common plant.

View More Free Quizzes
Related BrainMass Solutions

  • To make primers and use them for site directed mutagenesis

    Criteria for designing PCR primers are listed. A brief description of the site directed mutagenesis needed to change a BamHI restriction site into an EcoRI site is shown.

  • PCR process

    In some other cases you may want to use less specific primers for PCR to put you in a ball park faster. For example you could design a series of primers that establish aerobic, anaerobic and antibiotic resistance sequences.

  • Polymerase chain reaction

    Annealing temperature in combination with salt concentration dictate the specificity of the reaction. By placing more salt in the reaction the magnesium can interact with the primer and template to allow for more non-specific reactions.

  • What is the Polymerase Chain Reaction?

    Annealing: In this step, primers that have been designed specifically for the DNA strand of interest, will hybridize with the sample DNA providing a starting point for the DNA polymerase to attach and begin the DNA replication process.

  • Polymerase chain reaction problem

    With the primers provided you will be amplifying a shorter target seqence within this genomic sequence.

  • Factor V Leiden Mutation

    If you are designing primers, you will likely want to stay within the exon of your sequence change (the exon that 1691 is contained in).

  • DNA cloning and genetic disease

    For more information see: http://www.pcr-encyclopedia.com/pcr-principle-diagnosis-1095.html http://en.wikipedia.org/wiki/Polymerase_chain_reaction Paragraph with web reference answering two short questions involving gene cloning and disease diagnosis

  • Amplify a Stretch of DNA

    The enzyme typically used for PCR is a thermostable DNA polymerase such as Taq polymerase. The solution assists with amplifying a stretch of DNA with the given sequence using the polymerase chain reaction.

  • DNA Replications, Testing, and PCR

    In DNA synthesis, a natural primer is needed to start the DNA replication process. (1) Likewise, in PCR, there have to be two primers to start the PCR reaction.

View More Related Solutions