Explore BrainMass
Share

Explore BrainMass

    Designing primers for PCR: finding problems with primers

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

    2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

    a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
    reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

    b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
    reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

    c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
    reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

    © BrainMass Inc. brainmass.com October 9, 2019, 9:07 pm ad1c9bdddf
    https://brainmass.com/biology/sequencing/designing-primers-pcr-finding-problems-primers-173612

    Solution Preview

    The temperature stable DNA polymerase is needed because this enzyme must survive the high temperature of PCR denaturing cycles. Otherwise fresh enzyme ...

    Solution Summary

    Why use a temperature-stable polymerase in PCR reactions is determined. The expert determines what features of PCR primers may cause practical problems in PCR reactions.

    $2.19