Explore BrainMass
Share

Polymerase chain reaction problem

This content was STOLEN from BrainMass.com - View the original, and get the already-completed solution here!

I have using sterile technique, made up in an eppendorf tube the following:
Sterile water 15 ul,
primer 1 @ 30ng/ul,
primer 2 @ 30 ng/ul,
DNA Preparation (listeria or e.coli 5 ul),
Mastermix 25 ul.

I mixed the tubes and heated them, and carried out the elecrophoresis
for staining to obtain a photograph.
I need to draw a diagram to explain why the precise target sequence is not amplified until the third cycle of the PCR, also, how is the value of the annealing temperature is determined for a given P.C.R protocol.

Can you help?

© BrainMass Inc. brainmass.com October 24, 2018, 10:33 pm ad1c9bdddf
https://brainmass.com/biology/human-biology/polymerase-chain-reaction-problem-163104

Solution Preview

The precise target sequence that you are amplifying will not appear until the third cycle of PCR. According to the starting materials you have provided, you have begun your reaction with DNA from a bacteria. This DNA will be a full length genomic DNA sequence. With the primers provided you will be amplifying a shorter target seqence within this genomic sequence.

To do this question (and as a helpful guide to answering future PCR qeustions) it helps to write out the reaction steps with the 5' and 3' ends labelled. Keeping in mind that with each cycle the DNA polymerase synthesizes a new DNA strand complementary to the DNA template strand by adding dNTP's that are complementary to the template in the 5' to 3' direction, condensing the 5'-phosphate group of the dNTPs with the 3'-hydroxyl group at the end of the nascent (extending) DNA strand.

So with cycle one:

Your genomic sequence:

5'----------------------------------------3'
3'----------------------------------------5'

Let's assume that your primers will anneal to a target sequence within the above genomic sequence. ...

Solution Summary

This question is a typical problem encountered in laboratories. The solution shows step-by-step how to solve the question and provides helpful diagrams that outline the solution. There is also a link provided for further reading and extra information that can serve as a study guide.

$2.19
See Also This Related BrainMass Solution

Designing primers for PCR: finding problems with primers

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

View Full Posting Details