Purchase Solution

Amplify a Stretch of DNA

Not what you're looking for?

Ask Custom Question

You would like to amplify a stretch of DNA with the following sequence using the polymerase chain reaction:

5' GTGTTTAGTGGGCGGTAACCGTTACGTAGGTAATGCT 3'

Assume (unrealisitcally) that you will use 5 nucleotide long primers positioned to amplify the entire sequence.
a) What are the sequences of the two primers you would use?
b) What enzyme would you use in your reaction?

Purchase this Solution
Solution Summary

The solution assists with amplifying a stretch of DNA with the given sequence using the polymerase chain reaction.

Solution Preview

5' GTGTTTAGTGGGCGGTAACCGTTACGTAGGTAATGCT 3'

Remember, the primers must bind to either end of this molecule. In addition, DNA polymerization occurs in the 5' to 3' direction. That's ...

Purchase this Solution
Free BrainMass Quizzes
Identifying Variables in Science Experiments, Part 2

Using sample experiments, test yourself to see if you can identify independent, dependent, and controlled variables. Identifying variables is key in understanding and developing experiments. The questions are biology related, but this can be applied to any area of science.

BIOLOGY

Basics in biology

Basic Concepts in Neuroscience

This quiz provides a review of the basic concepts in neuroscience.

Breastfeeding Basics

How much do you know about breastfeeding? Find out with this quiz!

Biochemistry Basics

A refresher quiz to test your knowledge of basics concepts of biochemistry.

View More Free Quizzes
Related BrainMass Solutions

  • Genetics - How can we amplify a segment of DNA?

    49689 Genetics - How can we amplify a segment of DNA? How can we amplify a segment of DNA? Describe the principles of the PCR (polymerasechain reaction) method. Please see the attachment.

  • Finding the Weight of DNA in a Human

    413145 Finding the Weight of DNA in a Human Calculate the weight in grams of a double-helical DNA molecule stretching from the Earth to the moon (~320,000 km).

  • Determining the GC Ratio

    Determine the GC ratio of the following stretch of DNA from 2 different bacteria: Bacterium #1: GCATTAGCCGTATCCGAT CGTAATCGGCATAGGCTA Bacterium #2: CGACCGGCCATGGCGCGT GCTGGCCGGTACCGCGCA What conclusion would you draw about the relatedness

  • New Developments in DNA Sequencing Technology.

    Now, using PCR and properly designed primers, one can amplify any DNA sequence whether it's in a cloning plasmid or simply a PCR amplicon.

  • Taking Advantage of Retrotransposons

    Retrotransposons are genetic elements that amplify themselves in a genome. They are ubiquitous parts of the DNA. First they copy themselves to RNA and then back to DNA, which can integrate back into the genome.

  • What is the Polymerase Chain Reaction?

    They consist of dATP, dCTP, dGTP and dTTP. The polymerase will use these units to construct the new DNA strands. Sample DNA: The sample DNA is the DNA one wishes to amplify.

  • restriction enzyme fingerprinting

    A pair of primer is designed to amplify a segment of the STS starting from genomic DNA by PCR, and the primers test for the presence of the STS in a sample of DNA. The sequence of the primers should be unique.

  • yeast and human genes

    Subjecting human DNA to PCR using these primers would then amplify the homologous sequence, which could be used for sequencing, and then compared with the sequence of the yeast gene to determine the exact homology.

  • Gene Cloning, Manipulation, & Applications

    -PCR amplify your cDNA of interest from your cDNA pool and insert it into a bacterial vector. -transform the vector containing your cDNA of interest in to bacteria and amplify the bacteria to make more copies of it.

View More Related Solutions