Explore BrainMass
Share

Explore BrainMass

    Amplify a Stretch of DNA

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    You would like to amplify a stretch of DNA with the following sequence using the polymerase chain reaction:

    5' GTGTTTAGTGGGCGGTAACCGTTACGTAGGTAATGCT 3'

    Assume (unrealisitcally) that you will use 5 nucleotide long primers positioned to amplify the entire sequence.
    a) What are the sequences of the two primers you would use?
    b) What enzyme would you use in your reaction?

    © BrainMass Inc. brainmass.com October 9, 2019, 6:01 pm ad1c9bdddf
    https://brainmass.com/biology/dna-chromosomes-and-genomes/amplify-stretch-dna-75828

    Solution Preview

    5' GTGTTTAGTGGGCGGTAACCGTTACGTAGGTAATGCT 3'

    Remember, the primers must bind to either end of this molecule. In addition, DNA polymerization occurs in the 5' to 3' direction. That's ...

    Solution Summary

    The solution assists with amplifying a stretch of DNA with the given sequence using the polymerase chain reaction.

    $2.19