Purchase Solution

How is mRNA formed from DNA?

Not what you're looking for?

Ask Custom Question

How is mRNA formed from DNA?

Purchase this Solution
Solution Summary

This solution explain the process (transcription) in which mRNA is derived out of DNA.

Solution Preview

DNA provides instructions for the formation of RNA by a process called "transcription." The DNA molecule acts as a template for the RNA molecule. DNA is made up of the nucleotides Adenine (A), Thymine (T), Cytosine (C) and Guanine (G). RNA is made of the nucleotides A, C, and G; instead of T, RNA uses Uracil (U). The RNA nucleotides can base pair with the DNA nucleotides. An A DNA molecule will pair ...

Purchase this Solution
Free BrainMass Quizzes
Do You Know Your Macromolecules?

This quiz will assess your knowledge of the macromolecules that are important to living things.

Basic Immunology Quiz

Intro to immuno quiz. Covers the basics of immunology and recognition of foreign substances by the body.

Comfort Measures For Labor

Are you ready to doula someone through labor?

Hemophilia: Fact or Fiction

Do you know the truth about hemophilia? Test your knowledge here.

Breast Milk and Breastfeeding

How much do you know about breast milk and breastfeeding? Double check your knowledge level with this quiz!

View More Free Quizzes
Related BrainMass Solutions

  • Two functions of DNA

    Process of transcription: Formation of mRNA from DNA. In eukaryotic cells it occurs in nucleus. formation in DNA is copied in the form of mRNA.

  • DNA Synthesis and RNA Transcription

    Three main types of RNA: mRNA - mRNA transcribes the genetic code from DNA into a form that can be read and used to make proteins. mRNA carries genetic information from nucleus to the cytoplasm of a cell.

  • DNA code to Amino Acid

    Transcription is the synthesis of mRNA from a DNA template. (1) DNA unwinds. (2) RNA polymerase recognizes a specific base sequence in the DNA called a promoter and binds to it.

  • complementary base pairing in DNA

    . ============ Write the base sequence for the mRNA that would be formed during transcription from the DNA template strand with the base sequence 5'-CGGATATTG-3'. The mRNA is made directly off of the template strand.

  • Creating a Recombinant Microorganism

    Describe the process of transcription (how mRNA is made from DNA) and describe how translation changes mRNA into proteins.

  • Transmission of Genetic Material

    The process of mRNA reading the code from DNA is called transcription and the reading of the mRNA by the tRNA and rRNA is called translation. Oh, DNA also has a 5' and 3' end. This is important. Be sure to look up why. All living things grow.

  • Protein Synthesis: Transcription and Translation

    Once the functional mRNA is formed, it is transported out of the nucleus and into the cytoplasm or rough ER to be used as a template for translation into a polypeptide chain.

  • Bacterial mRNA

    AUGUUUGCUGGGGGACAUUCGUGGGCA from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

  • Translation: How to determine an amino acid from mRNA.

    217433 Translation: How to determine an amino acid from mRNA. The nucleotide sequence of a DNA codon is GTA. In an mRNA molecule transcribed from this DNA, the codon has the sequence ___.

View More Related Solutions