1. What type of amino acid side chains would you expect to find folded on the interior of a globular protein? What kind of experimental evidence supports this claim?
2. Which amino acid lacks a stereoisomer and which has more than one asymmetric carbon?
3. What property of the DNA double helix allows us to say that the recognition site for a restriction endonuclease like BamHI (GGATCC) is a structural palindrom?
4. What general kind of quarternary structure do we expect to find for the restriction endonuclease PstI, which also recognizes a palindromic sructure?
Research is also given.
Solution Preview
Hello
1) Globular proteins have a tertiary structure that is compactly folded and coiled.
First, to backtrack: Primary structure refers to the amino acid sequence, which completely determines all other structural features of a protein. This is due to the distinct chemical properties of the amino acid side chains - details which I will leave for your text. each type of protein has particular secondary structural elements; in globular proteins this is mostly alpha-helices. The amino acid residues found in alpha helices are alanine, aspartic acid, glutamic acid, isoleucine, and leucine. In the interior of a ...
Please help me answer these questions about restriction enzymes.
What is a restriction endonuclease?
Why do molecular biologists use restriction enzymes?
What is the difference between type I and type II restrictionendonucleases and why are type II restrictionendonucleases more useful for molecular biologists than type I r
1. Digestion of the oligonucleotide, AGUACAA, by pancreatic RNase would yield what products?
2. A 5.5 kb, circular plasmid is cut with the following restrictionendonucleases, producing the fragments listed. Construct a restriction map for this plasmid.
Endonuclease DNA fragments (kb)
Eco RI 5.5
Pst I 5.5
Which of the below describes the correct order in which procedures are carried out when using the Southern Blot technique?
(a) Cutting the DNA with restriction enzyme, blotting the DNA, electrophoresis of DNA, hybridizing the DNA with probe.
(b) Cutting DNA with restriction enzyme, electrophoresis of DNA, blotting the DNA, hy
Restricted funds for Nonprofit fund accounting:
Can a nonprofit (not-for-profit) organization release restrictions on a "strike fund" and use it in the general fund for current year activity? Why or why not?
If you knew that the strike fund was held for steel workers' union to pay benefits during a potential strike versus a
See the attached problems
1. find the intercept, vertex, domain, and range, then graph the parabola
(1) y = x^2 + 2x - 3
(2) y = -x^2 -5x - 4
(3) a = b^2 -6b - 16
2. graph the parabola, state the domain and range:
(1) y = 1/3x^2 - 6
(2) y= -x^2 -1
(3) y = (x - 2)^2
When a country imposes a trade restriction on certain products, say in the form of import tariffs for the sake of protecting domestic industries againts competing foreign products, is trade still a win-win game? Why? Why not?
Who are the likely winners and losers within the country? Why?
In the following sequence find restriction sites for EcoRI, HindIII and Hae III.
Show how many fragments will be produced by restriction by all of these enzymes at the same time and their size,
Which of the fragments produced will have 5'-overhang, 3'-overhang or blunt end?
GAAGAACCTGAATTCAAATTTGGCCCTGCTGCTGAAGCTTGCTGACCAGG
5'tggtggtggaggctggggtcaaggtggtagccacagtcagtggaacaagcccagtaagccaaaaccaacaygaagcatgtggcaggagctgctgcagctggagcagtggtagggggccttggtggctacat3'
Can this sequence be cut by a restriction enzyme?
Can the fragments and coupled with electrophoresis be used to find a single substitution polymorphism?
