Purchase Solution

Corresponding section (CTAATGT) of mRNA

Not what you're looking for?

Ask Custom Question

Dna strand to be transcribes as CTAATGT so what is the corresponding section of the mRNA?

Purchase this Solution
Purchase this Solution
Free BrainMass Quizzes
Labor Comfort Measures

Do you know how to comfort someone in labor?

Bacterial Genetics

This quiz test your knowledge of the genetics of bacteria.

Identifying Variables in Science Experiments, Part 2

Using sample experiments, test yourself to see if you can identify independent, dependent, and controlled variables. Identifying variables is key in understanding and developing experiments. The questions are biology related, but this can be applied to any area of science.

Infant Development: Sleep

How much do you know about infant sleep? Test your knowledge with this quiz.

Feeding Babies

Do you know the science behind feeding babies? Test your knowledge with this quiz.

View More Free Quizzes
Related BrainMass Solutions

  • DNA Transcription & Replication

    What is the role of complementary base-pairing in each? If a section of the DNA strand to be transcribed is CTAATGT, what is the corresponding section of the mRNA?

  • Questions Related to Gene Sequences

    21655 DNA sequencing The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.

  • DNA template strand

    What is the sequence of the corresponding region of the mRNA?

  • Effect of nucleotide substitution mutation on protein

    Proteins are formed as a result of translation process during which amino acids, corresponding to the nucleotide sequences in mRNA, form peptide bonds. Each amino acid is coded by a set of 3 nucleotide sequence (codon) in mRNA.

  • Human Biology - mRNA

    44726 Human Biology - mRNA This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene.

  • How is mRNA formed from DNA?

    To make mRNA, RNA nucleotides will base pair with the corresponding DNA nucelotide on the DNA template. For example, if the DNA sequence is 5' ACTGAGCTA 3', the complementary RNA sequence will be 3' UGACUCGAU 5'.

  • translate mRNA

    Whenever you have a mRNA sequence as you have provided (I know it is RNA because it contains U instead of T and is single stranded not double stranded) the key to translating it is to remember that mRNA is translated in groups of 3 nucleotides at a time

  • Insertion in DNA

    what is the new mRNA sequence corresponding with this altered DNA Deletetion of the 10th base in the DNA sequence TACAAACGACCCCTGTAAGCACCCGT have removed the C what is the new mRNA sequence corresponding with this altered DNA I assume in the 2nd part

  • Discussing Short Double Stranded RNA

    When this complex binds to a corresponding mRNA that is complimentary to the siRNA, a nucleolytic process is initiated which causes the mRNA to be degraded.

View More Related Solutions