Explore BrainMass
Share

Explore BrainMass

    Insertion in DNA

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    Bacterial mRNA
    AUGUUUGCUGGGGGACAUUCGUGGGCA produced the following template strand from which this mRNA was transcribed
    TACAAACCACCCCCTGTAAGCACCCGT
    My questiohn is
    inserted a T at the begining of the sequence to produce
    TTACAAACGACCCCCTGTAAGCACCCGT
    what is the new mRNA sequence corresponding with this altered DNA
    Deletetion of the 10th base in the DNA sequence
    TACAAACGACCCCTGTAAGCACCCGT have removed the C
    what is the new mRNA sequence corresponding with this altered DNA

    I assume in the 2nd part the sequence starts with a single T could you help me out
    regards Sandie

    © BrainMass Inc. brainmass.com October 9, 2019, 4:06 pm ad1c9bdddf
    https://brainmass.com/biology/dna-chromosomes-and-genomes/insertion-dna-22615

    Solution Preview

    Sandie:

    As always, my first suggestion is that if anything I tell you seems to make no sense...open a book- there may be an explanation from a different perspective that will help. The National Library of Medicine at the US NIH has some excellent textbooks online, all electronically searchable and all completely free. My favorites are: Lubert Stryer's "Biochemistry 5;" "An Introduction to Genetic Analysis" by Gelbart, et al.; and "Molecular Biology of the Cell" by Watson, et al. Those 3 texts alone set me back 400 dollars (US) when I was in graduate school. Isn't technology grand? Attached file #1 has all of this data, properly formatted and with the hyperlinks to sources of information intact.

    When given a problem such as this one, there are several things to keep in mind. The first is that there is a quite distinct division of labor between the biological machinery that replicates the DNA, the machinery that replicates the mRNA and the linked processes ...

    $2.19