Explore BrainMass
Share

Explore BrainMass

    Discussing Short Double Stranded RNA

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    For the following short double stranded RNA, which strand is more likely to be incorporated into RISC complex?

    GUGCCAGACGCAAUGUUGACUU
    UUCACGGUCUgCGUUACAACUG

    A. top strand
    B. bottom strand

    © BrainMass Inc. brainmass.com October 9, 2019, 7:07 pm ad1c9bdddf
    https://brainmass.com/biology/dna-chromosomes-and-genomes/discussing-short-double-stranded-rna-108454

    Solution Preview

    How does this dsRNA cause gene suppression?
    This is the issue we need to understand in order to solve this problem. The dsRNA will unwind and become two short ssRNA molecules. These short RNA fragments (called small interfering RNA, or siRNA) bind to the RNA-induced silencing complex (RISC). When this complex binds to a corresponding mRNA that is complimentary to the siRNA, a nucleolytic process is initiated which causes the mRNA to be degraded.

    There is a really cool and helpful online flash animation of the process of siRNA preparation from dsRNA and the process of RISC formation and mRNA cleavage at the following site:
    http://www.nature.com/nrg/journal/v2/n2/animation/nrg0201_110a_swf_MEDIA1.html

    Another good article can be found at http://www.scq.ubc.ca/?p=265.

    Therefore, in order to predict which of the two strands would be incorporated into the RISC, we need to ask another simple question. Which of the two strands would be complimentary to a ...

    Solution Summary

    This solution looks at the dsRNA introduced into the cells and explains why one strand is more likely to be incorporated within a RISC than the other in 658 words. References to animations and articles are also provided and will help to improve a student's understanding of this topic.

    $2.19