Discussing Short Double Stranded RNA
Not what you're looking for?
For the following short double stranded RNA, which strand is more likely to be incorporated into RISC complex?
GUGCCAGACGCAAUGUUGACUU
UUCACGGUCUgCGUUACAACUG
A. top strand
B. bottom strand
Purchase this Solution
Solution Summary
This solution looks at the dsRNA introduced into the cells and explains why one strand is more likely to be incorporated within a RISC than the other in 658 words. References to animations and articles are also provided and will help to improve a student's understanding of this topic.
Solution Preview
How does this dsRNA cause gene suppression?
This is the issue we need to understand in order to solve this problem. The dsRNA will unwind and become two short ssRNA molecules. These short RNA fragments (called small interfering RNA, or siRNA) bind to the RNA-induced silencing complex (RISC). When this complex binds to a corresponding mRNA that is complimentary to the siRNA, a nucleolytic process is initiated which causes the mRNA to be degraded.
There is a really cool and helpful online flash animation of the process of siRNA preparation from dsRNA and the process of RISC formation and mRNA cleavage at the following site:
http://www.nature.com/nrg/journal/v2/n2/animation/nrg0201_110a_swf_MEDIA1.html
Another good article can be found at http://www.scq.ubc.ca/?p=265.
Therefore, in order to predict which of the two strands would be incorporated into the RISC, we need to ask another simple question. Which of the two strands would be complimentary to a ...
Purchase this Solution
Free BrainMass Quizzes
Infant Development: Sleep
How much do you know about infant sleep? Test your knowledge with this quiz.
Creating a Birth Plan
Preparing for a birth and want to make sure that you're including all the right information? Use this quiz to get on the right track and check your birth plan knowledge!
Comfort Measures For Labor
Are you ready to doula someone through labor?
Basic Immunology Quiz
Intro to immuno quiz. Covers the basics of immunology and recognition of foreign substances by the body.
Breast Milk and Breastfeeding
How much do you know about breast milk and breastfeeding? Double check your knowledge level with this quiz!