Purchase Solution

Discussing Short Double Stranded RNA

Not what you're looking for?

Ask Custom Question

For the following short double stranded RNA, which strand is more likely to be incorporated into RISC complex?

GUGCCAGACGCAAUGUUGACUU
UUCACGGUCUgCGUUACAACUG

A. top strand
B. bottom strand

Purchase this Solution
Solution Summary

This solution looks at the dsRNA introduced into the cells and explains why one strand is more likely to be incorporated within a RISC than the other in 658 words. References to animations and articles are also provided and will help to improve a student's understanding of this topic.

Solution Preview

How does this dsRNA cause gene suppression?
This is the issue we need to understand in order to solve this problem. The dsRNA will unwind and become two short ssRNA molecules. These short RNA fragments (called small interfering RNA, or siRNA) bind to the RNA-induced silencing complex (RISC). When this complex binds to a corresponding mRNA that is complimentary to the siRNA, a nucleolytic process is initiated which causes the mRNA to be degraded.

There is a really cool and helpful online flash animation of the process of siRNA preparation from dsRNA and the process of RISC formation and mRNA cleavage at the following site:
http://www.nature.com/nrg/journal/v2/n2/animation/nrg0201_110a_swf_MEDIA1.html

Another good article can be found at http://www.scq.ubc.ca/?p=265.

Therefore, in order to predict which of the two strands would be incorporated into the RISC, we need to ask another simple question. Which of the two strands would be complimentary to a ...

Purchase this Solution
Free BrainMass Quizzes
Infant Development: Sleep

How much do you know about infant sleep? Test your knowledge with this quiz.

Creating a Birth Plan

Preparing for a birth and want to make sure that you're including all the right information? Use this quiz to get on the right track and check your birth plan knowledge!

Comfort Measures For Labor

Are you ready to doula someone through labor?

Basic Immunology Quiz

Intro to immuno quiz. Covers the basics of immunology and recognition of foreign substances by the body.

Breast Milk and Breastfeeding

How much do you know about breast milk and breastfeeding? Double check your knowledge level with this quiz!

View More Free Quizzes
Related BrainMass Solutions

  • Double stranded virus genomes

    206502 Double stranded virus genomes Viruses vary in the makeup of their genetic material. Some have double-stranded DNA, but other viruses have genomes composed of single-stranded DNA, double-stranded RNA, or single-stranded RNA.

  • Key differences between DNA and RNA

    It is also double stranded save for a few exceptions. RNA serves a variety of functions that are generally associated with reading the DNA template and converting the genetic information encoded in the DNA into peptides.

  • Genetic Biology

    What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?

  • Chromatin and DNA modifications vs RNA

    c) Unique RNAi mechanisms and effects Unique RNA mechanisms and effects involve processing of the long double-stranded RNA fragments into short oligos by the DICER enzyme, the formation of RNA/protein complexes and the assembly of the RISC complex

  • Predicting base composition in Aspergillus niger and TMV

    TMV is a single stranded RNA virus and hence this prediction is not possible. The base pair stoichiometry of DNA is not applicable to RNA. Predicting base composition in Aspergillus niger and TMV is emphasized.

  • The Difference Between DNA and RNA

    DNA is typically a double-stranded molecule with a long chain of nucleotides. RNA is generally a single-stranded molecule in most of its biological roles and has a much shorter chain of nucleotides compared to DNA.

  • bacteriophages and lysogeny

    The genome can consist of single or double stranded DNA or single or double stranded RNA.

  • Genetics, Chromosomes, DNA, RNA

    (a)dna is usually double-stranded; rna is usually single stranded (b)nucleotides in dna contain a different sugar from the nucleotides in rna (c) rna contains the bases A,T,G, and C; dna contains bases A,C,G, and U (d) all (e)none Answer: (c) rna

  • What are carbohydrates? Give an example of a disaccharide.

    ii) State two differences between DNA and RNA . One of the main difference between DNA and RNA is sugar in DNA is deoxy ribose whereas in RNA, its ribose sugar. Another difference is RNA is single stranded whereas DNA is double stranded.

View More Related Solutions