Explore BrainMass
Share

Explore BrainMass

    Primer explanation for Factor V Leiden

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).

    I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?

    © BrainMass Inc. brainmass.com April 3, 2020, 10:55 pm ad1c9bdddf
    https://brainmass.com/biology/cell-and-molecular-biology/primer-explanation-factor-leiden-470466

    Solution Preview

    The forward primer anneals to 1581 to 1602 in exon 10 and the ...

    Solution Summary

    The solution provides explanation for primers used for Factor V Leiden.

    $2.19

    ADVERTISEMENT