Suppose you were to construct a synthetic RNA from a repeating dinucleotide AGAGAGAGAG and then use it as a messenger to synthesize a polypeptide in an in vitro system. What type of polypeptide would you make from this polynucleotide? Would you expect to have more than one polypeptide? Why?
The primary transcript or pre mRNA of a nuclear gene in a chimpanzee has the sequence 5'-G-exon1-AGGUAAGC-intron-CAGUC-exon2-A-3'. After the intron has been excised, what is the most likely sequence of the mRNA?
The human beta-globin polypeptide is 146 amino acids long. How long is the coding portion of the human beta-globin mRNA?
1. What sequence of nucleotide pairs in a Drosophila gene will encode the amino acid sequence met-trp-phe-trp-met (reading from the amino terminus to the carboxyl terminus)? 2. A wild type gene contains the trinucleotide-pair sequence: was 5'-GAG-3' changed to:5'-GTG-3' 3'CTC -5' 3'-CAC-5' If the second base
Using the provided DNA code, derive the correct amino acid sequence. Describe the necessary steps to arrive at the amino acid sequence, and explain each in detail. Make sure to list the mRNA sequence, and the amino acid sequence in your answer. DNA Code: T A C T T A C C G A G A T T C T T G T T T A T C
I need to complete a lab can you tell me what I will see: 1. Describe the appearance of the DNA as it precipitates out of solution. 2. Describe the appearance of the DNA after you have spooled it. 3. Describe the appearance of the DNA after you let it dry.
Although normal E.coli cells can synthesize all the amino acids, some mutants called amino acid auxotrophs, are unable to synthesize specific amino acids and require the addition of that amino acid to the culture medium for optimal growth. In addition to their role in protein synthesis, specific amino acids are also required in
How many Single Nucleotide Polymorphisms (SNPs) are present among the haplotypes? Which sites are non-segregating (i.e. non-polymorphic)?
A) How many unique haplotypes are present in the collection of 10 sequences (do not include the chimpanzee outgroup sequence)? Label the haplotypes accordingly in the second column of the table (the first two have been labeled for you, by way of example). What is the frequency of the most common haplotype in the sample?
Affinity Chromatography. Please follow directions and problems attached in Word Doc 9. Word Doc 2 explains the procedure used. See attached file for full problem description.
Describe what a "gene" is. Include a definition in addition to information on the structure of a gene and regulatory regions.
How many DNA fragments would be generated and what would be the size of each fragment if the restriction enzyme HaeIII was mixed with the following DNA sequence? 5' ACCGGCATTACGGCCTTACATGGCCATAGCCGGAACATCGT 3' 3' TGGCCGTAATGCCGGAATGTACCGGTATCGGCCTTGTAGCA 5'
What are the physical changes needed in the body that would need to happen in order for our bodies to live forever. Changes such as telomerase activity, collagen flexibility, environmental changes, role of the immune system, DNA repair enzymes: these all come into play. Construct a brief list (not to exceed 100 carefully ch
Purine biosynthesis is allowed to take place in the presence of [N15]aspartate, and the newly synthesized GTP and ATP are isolated. What positions are labeled in the two nucleotides?
Having a problem understanding Mendel's theory, would like help answering these scenario's. Have to write an report based on these questions please help Assume that "S" represents the dominant trait of having long leaves, and "s" represents the recessive short-leafed trait in a plant. In the parental generation, you cross
What is the significance of adenine, thymine, guanine, and cytosine in the structure of a DNA molecule? Explain how these four nucleotides bond with each other and other components of DNA. What evidence is there to support that this code carries hereditary instructions? Would like your answers to these questions and
In this experiment we used electrophoresis to study the binding interactions that occure between serum albumin and two synthetic dyes. The dyes were Bromophenol Blue and Ponceau S. The basis for this procedure was the observation that the free dyes not bound to albumin migrate faster than albumin or dyes bound to albumin. I
I do not understand the process of gene expression as given on certain cites. Please explain the process of gene expression in prokaryotes.
3. The urine of some people has a distinctive odor after eating asparagus. This appears to be a recessive trait. If a person with aromatic urine marries a person heterozygous for this trait, what phenotypic and genotypic ratios will their children theoretically exhibit? 4. Cat's tail has 42 chromosomes in each somatic cell.
What is involved in going from genomic DNA to messenger RNA (mRNA)? The transciption process involves the concerted action of several proteins called transcription factors which process the DNA in a multi-step process into mRNA.
Given the SNP genotyping information about the following individual: Individual 1: Aa Bb CC Dd Individual 2: aa bb CC DD Individual 3: Aa Bb CC DD Individual 4: aa Bb CC dd Individual 5: aa Bb CC Dd Use the Clark's algorithm to resolve the haplotypes for each individual. E.g. Individual 1 = (text field aBCd) + (text fi
For the following short double stranded RNA, which strand is more likely to be incorporated into RISC complex? GUGCCAGACGCAAUGUUGACUU UUCACGGUCUgCGUUACAACUG A. top strand B. bottom strand
How many tryptic products are there (integer) and what are their molecular weight *you don't have to fill in all the empty slots in the poll, just enter as many as there are fragments)? The molecular weight of amino acids are given attached. Based on the peptide molecular weight, is the protein more likely to be present in M
Two strands of a DNA molecule are radio-labeled such that each strand can be uniquely identified. After three bouts of replication, how many new molecules of DNA are formed? How many strands of DNA are radio-labeled? Are both radio-labeled strands in the same DNA molecule? Why or why not?
Genetic Biology Questions. See attached file for full problem description.
Question 2: Motif finding Try a number of motif-finding algorithms covered in the lab, and try different parameters. What good motif can you find from the sequence? Here are some useful hints for the analysis (depends on the software you are using): ? Motif width ~ 13, and search in both strands of the DNA ? Ask each algori
Study questions and electrophoresis gel are attached.
Predict Functional Domain of DNA Sequence. See attached file for full problem description.
What are ecosystem services? How would you respond to the critic who says, "Forests are only good for providing timber"? Support your answer with examples of at least four different ecosystem services offered by forests. Define genetic diversity and explain the importance of genetic diversity for crop plants and livestock. I
How many types of telophase II products can be formed if a homozygote (AA or aa) is under study? How many types of telophase II products can be formed if a heterozygote (Aa) is under study? How many kinds of gametes can be formed if the genotype is AABB? Make a drawing of this type of cell in Prophase I. Label the chromo