Explore BrainMass

DNA, Chromosomes and the Genomes

New phenotypes

Please help with the following problems. Provide step by step calculations. 1. One form of color blindness in humans is caused by a sex-linked recessive mutant gene (c). A woman with normal color vision (c+) and whose father was also color-blind marries a man of normal vision whose father was also color-blind. What proport

Genetics question

1. In peas, the chemical pisatin is associated with defense against parasitic fungi: normal plants are resistant to fungi and contain pisatin. Two pure lines were obtained, both of which lacked pisatin and were highly susceptible to fungal attack Line 1 was from California and line 2 was from Sweden. The lines were investigated

Dominant traits/recessive traits

Pattern baldness in humans is controlled by a single autosomal locus with two alleles (B and B'), but pattern baldness is a sex-influenced phenotype: baldness is dominant in males (BB and BB' males become bald), but recessive in females (only BB females become bald). if a population is in Hardy-Weinberg equilibrium for this lo

Polygenic traits

In the future, aliens who have invaded earth are conducting a survey of teenagers. when examining body modifications, they conclude that piercing is a polygenic trait. they reached this conclusion by examining only the number of piercings in a teenager, and the number of piercings in their parents. why might they conclude tha

AP Biology: Practice Test Review

AP Biology Test Review We are doing a mitosis and meiosis lab. I need help on these concept questions. 1. Why is it more accurate to call mitosis "nuclear replication" rather than "cellular division"? 2. Explain why the whitefish blastula and onion root tip are selected for a study of mitosis. 3. List three major diff

Specify the location and function of the centromere...

1. Specify the location and function of the centromere. The centromere is a region of a eukaryotic chromosome where the kinetochore is assembled thus; it is the site where spindle fibers of the mitotic spindle attach to the chromosome during mitosis. (Centromeres are highly complex chromosomal substructures involved in essenti

Chi squared analysis

In corn, colored aleurone (R) is dominant to colorless aleurone (r), and green plant color (G) is dominant to yellow plant color (g). two plants, each heterozygous for both characteristics, are testcrossed to homozygous recessives, and their progeny are combined to produce the following totals: colored green 100 colored ye

Restriction sites

In a restriction mapping experiment using the plasmid P (ST), you cleave the circular plasmid with the restriction enzymes Xbal, Asp718, BamHI and EcoRI individually and in various combinations with each other. You obtain DNA fragments with the following sizes: Enzymes used size of DNA fragments (bp) BamHI, EcoR


Please answer the following questions on FUNGI (attached). --- LAB 15-A 1- Do the hyphae of zygomycetes contain cross walls (sept)? 2- How would you describe the hyphae of Zygomycetes? LAB 15-B 1- Describe the hyphae of pezira 2- Are ascospores the result of asexual or sexual reproduction? LAB 15-C 1

Meiotic Nondisjunction

Meiotic nondisjunction events will create aneuploid gametes. Describe (with figures) normal Drosophila male meiotic segregation of the sex chromosomes. Then describe all possible outcomes if a Meiosis-I nondisjunction occurs; then do the same for Meiosis-II nondisjunction.

Reverse Transcriptase

What is reverse transcriptase and why do we find multiple copies of it in the human genome?


1.The basic differences between RNA and DNA are: a.The organic bases only b.Bases, ribose units, and the phosphodiester linkage c.Bases, ribose units, and the glycosidic bond type d.Bases and the ribose units only. 2.The solubility characteristics of the pyrimidine or purine bases and the corresponding nucleosides di


Genetically speaking, what do we know about birth defects caused by thalidomide, cocaine and alcohol?


What do we know about DNA damage caused by nuclear radiation (the Hiroshima and Nagasaki atomic bombs)?

Miscellaneous questions

1. A population of grasshoppers in the Kansas prairie has two color phenotypes, green and brown. Typically, the prairie received adequate water to maintain healthy, green grass. Assume a bird that eats grasshoppers moves into the prairie. How will this affect natural selection of the grasshoppers? How might this chang

DNA etc.

Discuss one agricultural and one medical application of biotechnology. Describe how the technique of gene therapy might help someone with an inherited genetic disease. Discuss some of the bioethical concerns related to screening for genetic diseases.

Polymerase Chain Reaction - PCR

I am legally blind and therefore, I cannot see the board in the classroom, and I also cannot read regular print because my vision is too low. That is why I need your help in solving the review problems below. Please send me the correct answers to all nine problems and write large and clear, using high contrast such as a thic

Human biology - mRNA

This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene. AUGUUUGCUGGGGGACAUUCGUGGGCA from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcrib


Suppose the (1) ____ oocyte is on its way down an oviduct when a female and male are engaged in sexual intercourse, or (2) _____. The male sex act requires (3) _____________ and ejaculation. During coitus, pelvic thrusts stimulate the penis, the female's (4) ____________, and the vaginal wall. The mechanical stimulation induces


FSH and (1) _______ stimulate cells outside the zona pellucida to secrete (2) _____. A(n) estrogen-containing fluid accumulates in the follicle, and estrogen levels in the blood begin to increase. About eight to ten hours before being released from the ovary, the (3) _____ completes Meiosis I. And then its (4) _____ divides, for

Protein degradation

In addition to protein phosphorylation and dephosphorylation, protein degradation also plays key role in regulating signal transduction pathways and cell proliferation. Please answer the following questions: (1). Please give one example to describe how protein degradation regulates signal transduction pathway; (2) Plea

Monomeric receptors

Why can't a monomeric receptor tyrosine kinase recruit proteins to the receptor? What would happen if the GTP-ASE protein(GAP) were inhibited? EDIT: I have found the answer to the the second question posted here. However, I believe I have discovered the answer to the first question, but I fail to understand it. Can someone


If the G protein alpha subunit has a mutation so that it can't hydrolyze GTP, what happens?. If the G-protein can only bind to GDP how would that effect the pathway? I believe if the alpha subunit has a mutation and cant hydrolyze GTP then the G-protein will be unable to inactivate itself. How will this be bad?

Molecular switches

Someone with knowledge about GEF's and GAP's please help me understand what this means. In the regulation of molecular switches, protein kinases and guanine nucleotide exchange factors(GEF's) turn proteins on and protein phosphotases and GTPase activating proteins(GAP's) turn proteins off.

Protein expression / Pulse-chase

I want to study a human protein(protein X) that is normally secreted from the cell. I express the gene for Protein X in cultured Rat cells. I conduct a pulse-chase experiment in which I specifically label Protein X(and no other cellular protein) at 37 degrees celcius and then perform a 35 minute chase also at 37 degrees celcius

Life on earth (biological concepts from the non-science major perspective)

I have a major question about the hereditary genes. Using Mendelian genetics you can determine the likelihood of your eye color, your hair color, some things that fall in these lines, but at the age of 25 I would like to know how I can determine when I will have a head full of white hair. My father has some white hair and my


A man has genotype AA, Bb, cc, DD, ee, FF. what would be the genotypes of any and all sperm he might produce considering all six genes

Phenotypic ratios

What phenotypic ratio would be expected in offspring from a cross of Aa CC x aa CC if gene "a" and gene "c" were independent and A = long hair, a = short hair, C = brown coat, and c = white coat