Share
Explore BrainMass

DNA, Chromosomes and the Genomes

Insertion in DNA

Bacterial mRNA AUGUUUGCUGGGGGACAUUCGUGGGCA produced the following template strand from which this mRNA was transcribed TACAAACCACCCCCTGTAAGCACCCGT My questiohn is inserted a T at the begining of the sequence to produce TTACAAACGACCCCCTGTAAGCACCCGT what is the new mRNA sequence corresponding with this altered DNA Deletetion of th

Diagram it on chromosomes linkages

In Aspergillus, the genes y (yellow), os (osmotic), c (colonial), leu (leucine-requiring), and a (aconidial) are located on the long arm of chromosome 3. A diploid was made between a haploid wild type and a haploid of genotype y os c leu a. From the green diploid, yellow diploid sectors appeared. When these were sampled and test

What is the Polymerase Chain Reaction?

The Polymerase Chain Reaction (PCR), devised by Kary Mullis in the mid-1980's has revolutionized molecular biology by allowing a whole new approach to the study and analysis of genes. i) What is PCR? ii) What are the steps involved? iii) What are the necessary reagents involved in making the PCR work?

Genetics punnet square, sex lethal etc

In sheep the polled condition ( hornless ) is controlled by a single gene locus with two alleles. Heterozygous females are polled but heterozygous males have horns. Suppose two Heterozygous sheep were crossed. Refer to attachment for multiple choice questions. In sheep the polled condition ( hornless ) is controlled by a sing

Predicting DNA structure

A double stranded DNA virus has 200,000 base pairs. Determine the number of nucleotides present and the total number of complete spirals. How long will this DNA be?

Amino acid number prediction following mRNA sequence

How many different mRNAs would specify the following amino acid sequences - a) met - phe - ser - pro b) ile - arg - phe - leu - ala [use the triplet codon chart to find the number of codons representing the amino acids]

General formula for calculating length of DNA

Suppose 25,000 μm is 1 inch. Enumerate a formula to find the length of a DNA molecule in inches a) if the length is known in μm and b) only the number of nucleotide pairs is given.

Composition of bases in yeast

DNA of a certain species of yeast has thymidilic acid content of 32.6%. If the A/T ratio is 0.97, what is the composition of deoxyadenylic acid?

Chromosome number in different body cells

An animal cell has 46 post-mitotic chromosomes in each of its somatic cells. How many chromosomes should be present in the following cells- a) Mature egg, b) 1st polar body, c) Sperm, d) Spermatid, e) Primary spermatocyte, f) Brain cell, g) Secondary oocyte, h) Spermatogonium.

Chi-square testing

Cross between pure red tomato and yellow tomato produced all red F1 progeny. From the F2 progeny of 400 plants, 90 were yellow. Hypothesize that a single pair of allele is involved such that Y- = Red and yy = Yellow. Test this hypothesis using Chi square test.

Understanding the DNA structure is achieved.

If you extract the DNA of the coliphate thetaX174, you will find that its composition is 25 percent A, 33 percent T, 24 percent G, and 18 percent C. Does this make sense in terms of Chargaff's rules? How would you interpret this result? How might such a phage replicate its DNA? Ideas are expressed.

Mendelian heredity is summarized.

Consider two-child families in which the parents have been identified as carriers of an autosomal recessive gene by virtue of having at least one child with the phenotype. When the children of many such two-child families are totaled, what proportion of children in these families will show the phenotype? (Hint: The answer is N

Understanding Mendelian genetic heredity.

When a pea plant of genotype Aa Bb produces gametes, what proportion will be Ab? (Assume that the two genes are independent) (a) 3/4 (b) 1/2 (c) 9/16 (d) none (e) 1/4

Analyzing Western Blots, etc.

I took photographs of 3 stains: SDS-PAGE analysis of C. elegans protein extract (Coomassie Blue Staining), Western Blot of C. Elegans protein, and Indirect Immunofluorescence Staining. There are 3 photos attached .How do you analyze these stains? I need help discussing these results.

Cell Biology Homework

1. Digestion of the oligonucleotide, AGUACAA, by pancreatic RNase would yield what products? 2. A 5.5 kb, circular plasmid is cut with the following restriction endonucleases, producing the fragments listed. Construct a restriction map for this plasmid. Endonuclease DNA fragments (kb) Eco RI 5.5 Pst I 5.5

Cell Biology Homework

1. When DNA samples A and B were separated by buoyant density centrifugation the two samples migrated 23 and 15 cm, respectively. If DNA B had a GC content of 34%, what was the GC content of DNA A? 2. If Meselson and Stahl found that the ratio of 15N-labeled single-strands to 14N-labeled single-strands was 2:6 in the secon

Cell Biology: DNA and Viruses

1. Bacteriophage M13 infects E. coli differently from the way bacteriophage T2 does. The M13 coat is removed in the inner membrane of the bacterial cell, where it is sequestered during phage replication. It is subsequently used to package the newly replicated phage DNA to create progeny phage. Why would this make M13 less su

Descriptive Techniques used for Biological Changes

For the first question, I thought PCR might have something to do with it, but it seems to restrictive. I can't think of any other descriptive techniques. can anyone suggest any? For question 2, it look simple but when a deletion occurs does it happen to the top and bottom strand? I was just wondering because that changes the