Share
Explore BrainMass

DNA, Chromosomes and the Genomes

Gene linkage

The following cross involving three genes was performed: Aa Bb Cc x aa bb cc, and the phenotypes and number of progeny are shown below. Each pair of alleles exhibits simple dominance and recessiveness. Progeny Phenotype Number of progeny A B C 181 a b c 169 a B

Discussing the RAS Protein

Question: You are given a mutant cell that lacks the GTPase activating protein. What abnormalities would one expect to find in the way that RAS activity responds to extra-cellular signals? Why?

This job features tyrosine kinase.

In a series of experiments, genes that code for mutant forms of a receptor tyrosine kinase are introduced into cells. The cells also express their own normal form of the receptor from their normal gene, although the mutant genes are constructed so that they are expressed at considerably higher concentrations than the normal gen

Corn plants, mutant mouse

7. In corn plants, a dominant allele "I" inhibits kernel color, while the recessive allele "i" permits color when homozygous. At a different locus, the dominant gene "P" causes purple kernel color, while the homozygous recessive genotype pp causes red kernels. If plants heterozygous at both loci are crossed, what will be the ph

Problem Set

(See attached file for full problem description) --- 1. In the following pedigree, assume no outsiders marrying in carry a disease allele. A. What is the mode of inheritance of this disease? Circle one. (1 point) Autosomal dominant; Autosomal recessive; X-linked dominant; Y-linked; mitochondrial inheritance;

Biology problem

If a man with a red-colorblindness (a sex-linked trait) marries a normal woman, would you expect to see the trait expressed in their children? Diagram the cross below to support your answer:

Biology problem

2.) A line of Drosophila melanogaster with ebony body and sepia eyes (line A) is crossed to a line with tan body and red eyes (line B). The F1 are all tan-bodied, red-eyed, and normal-winged. What proportion of gametes produced by line A have the dominant allele for both loci?_____________ What proportion of the gametes p

New phenotypes

Please help with the following problems. Provide step by step calculations. 1. One form of color blindness in humans is caused by a sex-linked recessive mutant gene (c). A woman with normal color vision (c+) and whose father was also color-blind marries a man of normal vision whose father was also color-blind. What proport

Genetics question

1. In peas, the chemical pisatin is associated with defense against parasitic fungi: normal plants are resistant to fungi and contain pisatin. Two pure lines were obtained, both of which lacked pisatin and were highly susceptible to fungal attack Line 1 was from California and line 2 was from Sweden. The lines were investigated

Dominant traits/recessive traits

Pattern baldness in humans is controlled by a single autosomal locus with two alleles (B and B'), but pattern baldness is a sex-influenced phenotype: baldness is dominant in males (BB and BB' males become bald), but recessive in females (only BB females become bald). if a population is in Hardy-Weinberg equilibrium for this lo

Polygenic traits

In the future, aliens who have invaded earth are conducting a survey of teenagers. when examining body modifications, they conclude that piercing is a polygenic trait. they reached this conclusion by examining only the number of piercings in a teenager, and the number of piercings in their parents. why might they conclude tha

AP Biology: Practice Test Review

AP Biology Test Review We are doing a mitosis and meiosis lab. I need help on these concept questions. 1. Why is it more accurate to call mitosis "nuclear replication" rather than "cellular division"? 2. Explain why the whitefish blastula and onion root tip are selected for a study of mitosis. 3. List three major diff

Specify the location and function of the centromere...

1. Specify the location and function of the centromere. The centromere is a region of a eukaryotic chromosome where the kinetochore is assembled thus; it is the site where spindle fibers of the mitotic spindle attach to the chromosome during mitosis. (Centromeres are highly complex chromosomal substructures involved in essenti

Chi squared analysis

In corn, colored aleurone (R) is dominant to colorless aleurone (r), and green plant color (G) is dominant to yellow plant color (g). two plants, each heterozygous for both characteristics, are testcrossed to homozygous recessives, and their progeny are combined to produce the following totals: colored green 100 colored ye

Restriction sites

In a restriction mapping experiment using the plasmid P (ST), you cleave the circular plasmid with the restriction enzymes Xbal, Asp718, BamHI and EcoRI individually and in various combinations with each other. You obtain DNA fragments with the following sizes: Enzymes used size of DNA fragments (bp) BamHI, EcoR

FUNGI

Please answer the following questions on FUNGI (attached). --- LAB 15-A 1- Do the hyphae of zygomycetes contain cross walls (sept)? 2- How would you describe the hyphae of Zygomycetes? LAB 15-B 1- Describe the hyphae of pezira 2- Are ascospores the result of asexual or sexual reproduction? LAB 15-C 1

Meiotic Nondisjunction

Meiotic nondisjunction events will create aneuploid gametes. Describe (with figures) normal Drosophila male meiotic segregation of the sex chromosomes. Then describe all possible outcomes if a Meiosis-I nondisjunction occurs; then do the same for Meiosis-II nondisjunction.

Reverse Transcriptase

What is reverse transcriptase and why do we find multiple copies of it in the human genome?

Synthesis/RNA/DNA

1.The basic differences between RNA and DNA are: a.The organic bases only b.Bases, ribose units, and the phosphodiester linkage c.Bases, ribose units, and the glycosidic bond type d.Bases and the ribose units only. 2.The solubility characteristics of the pyrimidine or purine bases and the corresponding nucleosides di

Genetics

Genetically speaking, what do we know about birth defects caused by thalidomide, cocaine and alcohol?

Genetics

What do we know about DNA damage caused by nuclear radiation (the Hiroshima and Nagasaki atomic bombs)?

Miscellaneous questions

1. A population of grasshoppers in the Kansas prairie has two color phenotypes, green and brown. Typically, the prairie received adequate water to maintain healthy, green grass. Assume a bird that eats grasshoppers moves into the prairie. How will this affect natural selection of the grasshoppers? How might this chang

DNA etc.

Discuss one agricultural and one medical application of biotechnology. Describe how the technique of gene therapy might help someone with an inherited genetic disease. Discuss some of the bioethical concerns related to screening for genetic diseases.

Polymerase Chain Reaction - PCR

I am legally blind and therefore, I cannot see the board in the classroom, and I also cannot read regular print because my vision is too low. That is why I need your help in solving the review problems below. Please send me the correct answers to all nine problems and write large and clear, using high contrast such as a thic

Human biology - mRNA

This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene. AUGUUUGCUGGGGGACAUUCGUGGGCA from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcrib