Share
Explore BrainMass

DNA, Chromosomes and the Genomes

Restriction enzymes

In the following sequence find restriction sites for EcoRI, HindIII and Hae III. Show how many fragments will be produced by restriction by all of these enzymes at the same time and their size, Which of the fragments produced will have 5'-overhang, 3'-overhang or blunt end? GAAGAACCTGAATTCAAATTTGGCCCTGCTGCTGAAGCTTGCTGACCAGG

Digestion and Electrophoresis of DNA in Dogs

The restriction enzyme Scs1 cuts at a restriction site that is found only very rarely in dog genomes. One dog, Jimmy, has two restriction sites for this restriction enzyme in his genome. Another dog, Billy, has three restriction sites for this enzyme in his genome. For this problem assume there is only one chromosome in dogs.

Transcript of a Nuclear Gene in a Chimpanzee

The primary transcript or pre mRNA of a nuclear gene in a chimpanzee has the sequence 5'-G-exon1-AGGUAAGC-intron-CAGUC-exon2-A-3'. After the intron has been excised, what is the most likely sequence of the mRNA?

Transcription

1. What sequence of nucleotide pairs in a Drosophila gene will encode the amino acid sequence met-trp-phe-trp-met (reading from the amino terminus to the carboxyl terminus)? 2. A wild type gene contains the trinucleotide-pair sequence: was 5'-GAG-3' changed to:5'-GTG-3' 3'CTC -5' 3'-CAC-5' If the second base

Amino acids and nitrogen products

Although normal E.coli cells can synthesize all the amino acids, some mutants called amino acid auxotrophs, are unable to synthesize specific amino acids and require the addition of that amino acid to the culture medium for optimal growth. In addition to their role in protein synthesis, specific amino acids are also required in

Affinity Chromatography

Affinity Chromatography. Please follow directions and problems attached in Word Doc 9. Word Doc 2 explains the procedure used. See attached file for full problem description.

What is Necessary for Bodies to Live Forever

What are the physical changes needed in the body that would need to happen in order for our bodies to live forever. Changes such as telomerase activity, collagen flexibility, environmental changes, role of the immune system, DNA repair enzymes: these all come into play. Construct a brief list (not to exceed 100 carefully ch

Mendel/Punnett Square/Genotypes

Having a problem understanding Mendel's theory, would like help answering these scenario's. Have to write an report based on these questions please help Assume that "S" represents the dominant trait of having long leaves, and "s" represents the recessive short-leafed trait in a plant. In the parental generation, you cross

Structure of DNA

What is the significance of adenine, thymine, guanine, and cytosine in the structure of a DNA molecule? Explain how these four nucleotides bond with each other and other components of DNA. What evidence is there to support that this code carries hereditary instructions? Would like your answers to these questions and

Specificity of Albumin Binding

In this experiment we used electrophoresis to study the binding interactions that occure between serum albumin and two synthetic dyes. The dyes were Bromophenol Blue and Ponceau S. The basis for this procedure was the observation that the free dyes not bound to albumin migrate faster than albumin or dyes bound to albumin. I

Gene Expression

I do not understand the process of gene expression as given on certain cites. Please explain the process of gene expression in prokaryotes.

Genetics problems

3. The urine of some people has a distinctive odor after eating asparagus. This appears to be a recessive trait. If a person with aromatic urine marries a person heterozygous for this trait, what phenotypic and genotypic ratios will their children theoretically exhibit? 4. Cat's tail has 42 chromosomes in each somatic cell.

Describe the process of transcription in eukaryotes.

What is involved in going from genomic DNA to messenger RNA (mRNA)? The transciption process involves the concerted action of several proteins called transcription factors which process the DNA in a multi-step process into mRNA.

After three bouts of replication, how many new molecules

Two strands of a DNA molecule are radio-labeled such that each strand can be uniquely identified. After three bouts of replication, how many new molecules of DNA are formed? How many strands of DNA are radio-labeled? Are both radio-labeled strands in the same DNA molecule? Why or why not?

Motif finding

Question 2: Motif finding Try a number of motif-finding algorithms covered in the lab, and try different parameters. What good motif can you find from the sequence? Here are some useful hints for the analysis (depends on the software you are using): ? Motif width ~ 13, and search in both strands of the DNA ? Ask each algori

DNA sequencing

Predict Functional Domain of DNA Sequence. See attached file for full problem description.

Ecosystem Services - Biodiversity

What are ecosystem services? How would you respond to the critic who says, "Forests are only good for providing timber"? Support your answer with examples of at least four different ecosystem services offered by forests. Define genetic diversity and explain the importance of genetic diversity for crop plants and livestock. I

Genetics/Meiosis questions

How many types of telophase II products can be formed if a homozygote (AA or aa) is under study? How many types of telophase II products can be formed if a heterozygote (Aa) is under study? How many kinds of gametes can be formed if the genotype is AABB? Make a drawing of this type of cell in Prophase I. Label the chromo

Tetrahybrid cross: probabilities of genotypes

The genotype of F1 individuals in a tetrahybrid cross is AaBbCcDd. Assuming independent assortment of these four genes, what are the probabilities that F2 offspring will have the following genotypes? a)aabbccdd b)AaBbCcDd c)AABBCCDD d)AaBBCcDd e)AaBBCCdd Please help me on tackling problems like this in a systematic wa

Using Rules of Probability to Solve Genetics Problems

I'm totally lost in this subject especially when i have to solve problems using probability for trihybrid. I have of not knowing when to use the Rule of Addition and when to us the rule om Multiplication. I will try to show you what i know and maybe you can help me impron on what i already know. R r R(RR)(Rr) r(r

Describe the Control of Gene Expression

Question 1: Describe the control of gene expression In the Andalusian fowl, the allele for black feathers (B) is incompletely dominant to that for white feathers (b) and the phenotype of the heterozygote is described as blue. The texture of the feathers is controlled by a second gene locus, silky feathers (f) being recessive

Genetics: DNA and Chromosome Problems

1. Each cell of the human body contains 46 chromosomes. a. How many DNA molecules does this statement represent? b. How many different types of DNA molecules does it represent? 2. DNA is extracted from cells of Neurospora, a fungus that has one set of seven chromosomes; pea, a plant that has two sets of seven chromoso

Different single-stranded RNA's are composed of 99 nucleotides

If there are 20 amino acids commonly found in protiens, how many different dipeptides are there? How many different tripeptides? How many different trinucleotides(remember that nucleotides are the building blocks of DNA+RNA)?How many different single stranded RNA's are composed of 99 nucleotides?

DNA/Heredity

The Planning, Research and Development, Corp. is seeking grant money to continue their investigation on the relationship between DNA and heredity. You want it apply for the grant money to continue your internship research project. You thought it would help your case if you research projects where DNA research is being applied wi

I have to come up with a hypothesis and suggest an experiement utilizing mtDNA

I have not clue where to start on this or how to go about it. Apart from its essential role in cellular respiration, the mitochondrion is thought to be implicated in a variety disease states as well as the process of ageing. The mitochondrion contains its own circular DNA molecules (termed mtDNA) which largely encodes for pr

Various biology questions

1) Through a series of experiments with sterilized broth, Louis Pasteur disproved the idea of what? 2) To make a specific protein, ribosomes, a set of twenty strands of tRNA, and a strand of messenger RNA work together in a process called what? 3) The process by which a web-spinning spider makes a "sketch" of a web design

Probability Assumptions in Mating Pedigrees

(see diagram in the attached file) Answer the following questions based on the assumption that genotypes BB and Bb have brown eyes, while bb has blue eyes. Filled in the symbols in the pedigrees that represent blue eyes. a) What is the probability that the first child of a mating between II-2 and II-7 would be a blue-eyed

Probability

Answer the following questions based on the assumption that genotypes BB and Bb have brown eyes, while bb has blue eyes. Filled in the symbols in the pedigrees that represent blue eyes. a) What is the probability that the first child of a mating between II-2 and II-7 would be a blue-eyed girl? b) What is the probability th

DNA is discussed in plants and animals

There are a number of natural types of DNA. One is animal DNA, one plant DNA, another bacterial DNA. There are two types of DNA (one in plants and one in animal cells) that are part of cells but are not the main blueprint (not found in the nucleus) for the cell. What are these two types of DNA? Ideas are expressed.