Share
Explore BrainMass

DNA, Chromosomes and the Genomes

Ancestry DNA Tests

I'd just like to know: 1) are ancestry dna tests(mtDNA,Y-chromosome STR test) reliable? 2) in the case of Y-chromosome test,as long as they analyse markers on the Y chromosome,does it give ancestry only on the father of my father of my father.... or on the whole of my father's side(and his father,mother,etc.) If it gives ances

The Difference between Eukkaryotic and Prokaryotic mRNA

Eukaryotic genes differ than prokaryotic genes. Please explain, in depth, the post-transcriptional modification that a eukaryotic mRNA goes through before it leaves the nucleus and how this differs from the transcriptional events in a prokaryotic system.

Interpreting SDS-PAGE Gels

I have analysed some fish proteins using SDS-PAGE. My results varied but some showed a similar banding pattern between samples. My question is what does two similar banding patterns suggest?

Explanation for chromosomal aberration in animals and plants.

What is the impact of chromosomal aberration during Meiosis II, when the normal gametes generated as an end product of Meiosis II are compared with those produced from Meiosis II with chromosomal aberrations? What would happen when an abnormal gamete is crossed with a normal gamete produced from the end product of MeiosisII?

Theories of Biology

Evolution by Natural Selection, Inheritance, Cells, Biological Classification, Bioenergetics, Homeostasis, and Ecosystems. Summarize each of the major theories above. Inheritance - How is this theory relevant in the news today?

Strain of Aspergillus was subjected to mutagenesis by X rays

A strain of Aspergillus was subjected to mutagenesis by X rays, and two tryptophan-requiring mutants ( A and B) were isolated. These tryptophan-requiring strains were plated in large numbers to obtain revertants to wild type. You failed to recover any revertants from mutants A and recovered one revertant from mutant B. This r

Western Blot

Please see attachment for image. You ran your experiments on a gel and detected the proteins using a Western Blot (again remind yourself how do you make recombinant proteins, generate antibodies, and perform a Western). You results are demonstrated on this gel. The lanes are designated with the letter A-G. Vertical lines are

Effects of Altered Status/Growth and Development on Disease Processes

3. Explain why teratogens are difficult to identify. 4. Explain why a woman carrying the gene for hemophilia can produce two hemophiliac sons when she is mated to a normal male. 5. Under what conditions does a female acquire an X-linked recessive disorder? 7. The pedigree for Queen Victoria of England, a carrier

Genetic Isolation

If I were to use the scientific method as my framework- How do new species arise by genetic isolation? What would be your observations, questions, hypothesis, predictions, experiment (s) and finally the results in answering this question?

Mule - Hybrid of Horse & Donkey

Please see attached file. 1. A stable polyploidy plant species was found that has 26 chromosomes, which form 13 bivalents in meiosis. Is it an autoploid or alloploid? 2. Horses have 64 chromosomes, while donkeys have 62. Hybrids between horses and donkeys are mules, and are sterile. If two mules mated, with each prod

What will be the phenotypes and proportions of the progeny?

In fruit flies, black body (b) is recessive to gray body (b+), purple eyes (pr) is recessive to red eyes (pr+), and vestigial wings (vg) are recessive to normal wings (vg+). The loci coding for these traits are linked, with the following map distances: b____5_____pr_______5_______vg The interference among these gen

Restriction enzymes

In the following sequence find restriction sites for EcoRI, HindIII and Hae III. Show how many fragments will be produced by restriction by all of these enzymes at the same time and their size, Which of the fragments produced will have 5'-overhang, 3'-overhang or blunt end? GAAGAACCTGAATTCAAATTTGGCCCTGCTGCTGAAGCTTGCTGACCAGG

Digestion and Electrophoresis of DNA in Dogs

The restriction enzyme Scs1 cuts at a restriction site that is found only very rarely in dog genomes. One dog, Jimmy, has two restriction sites for this restriction enzyme in his genome. Another dog, Billy, has three restriction sites for this enzyme in his genome. For this problem assume there is only one chromosome in dogs.

Transcript of a Nuclear Gene in a Chimpanzee

The primary transcript or pre mRNA of a nuclear gene in a chimpanzee has the sequence 5'-G-exon1-AGGUAAGC-intron-CAGUC-exon2-A-3'. After the intron has been excised, what is the most likely sequence of the mRNA?

Transcription

1. What sequence of nucleotide pairs in a Drosophila gene will encode the amino acid sequence met-trp-phe-trp-met (reading from the amino terminus to the carboxyl terminus)? 2. A wild type gene contains the trinucleotide-pair sequence: was 5'-GAG-3' changed to:5'-GTG-3' 3'CTC -5' 3'-CAC-5' If the second base

DNA Code

Using the provided DNA code, derive the correct amino acid sequence. Describe the necessary steps to arrive at the amino acid sequence, and explain each in detail. Make sure to list the mRNA sequence, and the amino acid sequence in your answer. DNA Code: T A C T T A C C G A G A T T C T T G T T T A T C

Amino acids and nitrogen products

Although normal E.coli cells can synthesize all the amino acids, some mutants called amino acid auxotrophs, are unable to synthesize specific amino acids and require the addition of that amino acid to the culture medium for optimal growth. In addition to their role in protein synthesis, specific amino acids are also required in

Affinity Chromatography

Affinity Chromatography. Please follow directions and problems attached in Word Doc 9. Word Doc 2 explains the procedure used. See attached file for full problem description.

What is Necessary for Bodies to Live Forever

What are the physical changes needed in the body that would need to happen in order for our bodies to live forever. Changes such as telomerase activity, collagen flexibility, environmental changes, role of the immune system, DNA repair enzymes: these all come into play. Construct a brief list (not to exceed 100 carefully ch

Mendel/Punnett Square/Genotypes

Having a problem understanding Mendel's theory, would like help answering these scenario's. Have to write an report based on these questions please help Assume that "S" represents the dominant trait of having long leaves, and "s" represents the recessive short-leafed trait in a plant. In the parental generation, you cross

Structure of DNA

What is the significance of adenine, thymine, guanine, and cytosine in the structure of a DNA molecule? Explain how these four nucleotides bond with each other and other components of DNA. What evidence is there to support that this code carries hereditary instructions? Would like your answers to these questions and

Specificity of Albumin Binding

In this experiment we used electrophoresis to study the binding interactions that occure between serum albumin and two synthetic dyes. The dyes were Bromophenol Blue and Ponceau S. The basis for this procedure was the observation that the free dyes not bound to albumin migrate faster than albumin or dyes bound to albumin. I

Gene Expression

I do not understand the process of gene expression as given on certain cites. Please explain the process of gene expression in prokaryotes.

Genetics problems

3. The urine of some people has a distinctive odor after eating asparagus. This appears to be a recessive trait. If a person with aromatic urine marries a person heterozygous for this trait, what phenotypic and genotypic ratios will their children theoretically exhibit? 4. Cat's tail has 42 chromosomes in each somatic cell.