Explore BrainMass

DNA, Chromosomes and the Genomes

DNA sequencing

Predict Functional Domain of DNA Sequence. See attached file for full problem description.

Ecosystem Services - Biodiversity

What are ecosystem services? How would you respond to the critic who says, "Forests are only good for providing timber"? Support your answer with examples of at least four different ecosystem services offered by forests. Define genetic diversity and explain the importance of genetic diversity for crop plants and livestock. I

Genetics/Meiosis questions

How many types of telophase II products can be formed if a homozygote (AA or aa) is under study? How many types of telophase II products can be formed if a heterozygote (Aa) is under study? How many kinds of gametes can be formed if the genotype is AABB? Make a drawing of this type of cell in Prophase I. Label the chromo

Using Rules of Probability to Solve Genetics Problems

I'm totally lost in this subject especially when i have to solve problems using probability for trihybrid. I have of not knowing when to use the Rule of Addition and when to us the rule om Multiplication. I will try to show you what i know and maybe you can help me impron on what i already know. R r R(RR)(Rr) r(r

Describe the Control of Gene Expression

Question 1: Describe the control of gene expression In the Andalusian fowl, the allele for black feathers (B) is incompletely dominant to that for white feathers (b) and the phenotype of the heterozygote is described as blue. The texture of the feathers is controlled by a second gene locus, silky feathers (f) being recessive

Genetics: DNA and Chromosome Problems

1. Each cell of the human body contains 46 chromosomes. a. How many DNA molecules does this statement represent? b. How many different types of DNA molecules does it represent? 2. DNA is extracted from cells of Neurospora, a fungus that has one set of seven chromosomes; pea, a plant that has two sets of seven chromoso


The Planning, Research and Development, Corp. is seeking grant money to continue their investigation on the relationship between DNA and heredity. You want it apply for the grant money to continue your internship research project. You thought it would help your case if you research projects where DNA research is being applied wi

Transcription of DNA

Discuss transcription, including such things as the location in the cell, transcription signals, products, chemical details, and/or the amount of chromosome involved.

I have to come up with a hypothesis and suggest an experiement utilizing mtDNA

I have not clue where to start on this or how to go about it. Apart from its essential role in cellular respiration, the mitochondrion is thought to be implicated in a variety disease states as well as the process of ageing. The mitochondrion contains its own circular DNA molecules (termed mtDNA) which largely encodes for pr

Coefficient of Coincidence / Interference

F1 females from a cross of AABBCC to aabbcc were backcrossed to aabbcc males. IN the progeny of this cross there were 150 AaBbCc, 145 aabbcc, 55aabbCc, 52 AaBbcc, 31 aaBbcc, 29 AabbCc, 5 Aabbcc and 3 aaBbCc. Is there evidence of interference? What is the coefficient of coincidence?


Rarely, hens reverse phenotypic (not chromosomal dew late in life and develop into sprem producing males. If such a male were to be mated to a normal female, what sex ratio would be expected among the offsrping? (Eggs with no X chromosome do not hatch.)

Various biology questions

1) Through a series of experiments with sterilized broth, Louis Pasteur disproved the idea of what? 2) To make a specific protein, ribosomes, a set of twenty strands of tRNA, and a strand of messenger RNA work together in a process called what? 3) The process by which a web-spinning spider makes a "sketch" of a web design

5 small questions, simple answers needed (asap).

1) The allostery of an enzyme governor is likely to take two forms. They are? 2) In the process of making a protein, the purpose of an adaptor is to? 3) An allosteric receptor embedded in a cell membrane will change shape only when? 4) When the repair mechanism for DNA fails, the result is a what? 5) In the telophase


(see diagram in the attached file) Answer the following questions based on the assumption that genotypes BB and Bb have brown eyes, while bb has blue eyes. Filled in the symbols in the pedigrees that represent blue eyes. a) What is the probability that the first child of a mating between II-2 and II-7 would be a blue-eyed

Inverted and direct repeat

Imagine that you find a sequence 5' GTTTCA 3' at one end of a transposable element. a) Draw this sequence as an inverted repeat on both ends of the element (filling in the N's in the following format): 5GTTTCA-------------------------------NNNNNN3 3CAAAGT------------------------------NNNNNN5 B) draw this sequence as a dire

Restriction sites

You are attempting to map the restriction sites for Ecor I and BamH I on a circular DNA molecule. After conducting single digests with Ecor I and BamH I as well as a double digest, you obtain the following data: Ecor I BamH I Ecor I + BamH I fragment 1 8000bp 2500 bp


You would like to amplify a stretch of DNA with the following sequence using the polymerase chain reaction: 5' GTGTTTAGTGGGCGGTAACCGTTACGTAGGTAATGCT 3' Assume (unrealisitcally) that you will use 5 nucleotide long primers positioned to amplify the entire sequence. a) What are the sequences of the two primers you would use?


Eukaryotes may regulate gene expression at any number of levels. Imagine that transcripts of gene A are found only in the developing liver and transcripts of gene B are found only in the developing eye. List a general type of cis-regulatory sequence difference that could explain the expression difference between the two genes

Restriction enzyme

The restriction enzyme ECOR I cuts DNA leaving 5' overhangs, Pst I leaves 3' overhangs after cutting DNA and SMA I leaves blunt ends on the fragments it produces.Indicate wheter DNA ligase can join the following pieces of DNA. a) a fragment of human DNA that was generated by cutting with Ecor I and a plasmid DNA that was also c

Gene linkage

The following cross involving three genes was performed: Aa Bb Cc x aa bb cc, and the phenotypes and number of progeny are shown below. Each pair of alleles exhibits simple dominance and recessiveness. Progeny Phenotype Number of progeny A B C 181 a b c 169 a B

Discussing the RAS Protein

Question: You are given a mutant cell that lacks the GTPase activating protein. What abnormalities would one expect to find in the way that RAS activity responds to extra-cellular signals? Why?

This job features tyrosine kinase.

In a series of experiments, genes that code for mutant forms of a receptor tyrosine kinase are introduced into cells. The cells also express their own normal form of the receptor from their normal gene, although the mutant genes are constructed so that they are expressed at considerably higher concentrations than the normal gen

Corn plants, mutant mouse

7. In corn plants, a dominant allele "I" inhibits kernel color, while the recessive allele "i" permits color when homozygous. At a different locus, the dominant gene "P" causes purple kernel color, while the homozygous recessive genotype pp causes red kernels. If plants heterozygous at both loci are crossed, what will be the ph

Problem Set

(See attached file for full problem description) --- 1. In the following pedigree, assume no outsiders marrying in carry a disease allele. A. What is the mode of inheritance of this disease? Circle one. (1 point) Autosomal dominant; Autosomal recessive; X-linked dominant; Y-linked; mitochondrial inheritance;

Biology problem

If a man with a red-colorblindness (a sex-linked trait) marries a normal woman, would you expect to see the trait expressed in their children? Diagram the cross below to support your answer:

Biology problem

2.) A line of Drosophila melanogaster with ebony body and sepia eyes (line A) is crossed to a line with tan body and red eyes (line B). The F1 are all tan-bodied, red-eyed, and normal-winged. What proportion of gametes produced by line A have the dominant allele for both loci?_____________ What proportion of the gametes p