Explore BrainMass

Explore BrainMass

    DNA, Chromosomes and the Genomes

    Down Syndrome DNA Examined

    Is it possible for two people who have Down syndrome to give birth to a normal (without Down syndrome) child? If so, how would that be possible?

    How a Protein is Made

    Discuss/diagram the process from gene to protein. In other words, how do you build a protein based on a sequence of DNA? Thank you!

    Ovary and testis removal

    What changes, if any, would a male who has one testis removed experience? A female who has one ovary removed?

    Ancestry DNA Tests

    I'd just like to know: 1) are ancestry dna tests(mtDNA,Y-chromosome STR test) reliable? 2) in the case of Y-chromosome test,as long as they analyse markers on the Y chromosome,does it give ancestry only on the father of my father of my father.... or on the whole of my father's side(and his father,mother,etc.) If it gives ances

    The Difference between Eukkaryotic and Prokaryotic mRNA

    Eukaryotic genes differ than prokaryotic genes. Please explain, in depth, the post-transcriptional modification that a eukaryotic mRNA goes through before it leaves the nucleus and how this differs from the transcriptional events in a prokaryotic system.

    Cytogenetics (Theoretical) Project

    Would it be possible to investigate possible homology between the Y chromosome on an animal (eg; platypus) and the Y chromosome on a human - using FISH (fluorescent in situ hybridization)?

    Homology in X and Y Chromosome

    Roughly how long would it take to 'map' a 'Y' chromosome:days, weeks, months? Using FISH, human and animal X chromosomes have been compared. To look for homology, could this comparison also be done using Y chromosomes?

    Interpreting SDS-PAGE Gels

    I have analysed some fish proteins using SDS-PAGE. My results varied but some showed a similar banding pattern between samples. My question is what does two similar banding patterns suggest?

    Protein analysis of fish samples

    I have used a polyacrylamide gel in a protein analysis of fish samples. My question is why is this used instead of an agarose gel. and what is the purpose of the two reagents ammonium persulphate and TEMED when used to make polyacrylamid gels? Hope you can help.

    Explanation for chromosomal aberration in animals and plants.

    What is the impact of chromosomal aberration during Meiosis II, when the normal gametes generated as an end product of Meiosis II are compared with those produced from Meiosis II with chromosomal aberrations? What would happen when an abnormal gamete is crossed with a normal gamete produced from the end product of MeiosisII?

    Theories of Biology

    Evolution by Natural Selection, Inheritance, Cells, Biological Classification, Bioenergetics, Homeostasis, and Ecosystems. Summarize each of the major theories above. Inheritance - How is this theory relevant in the news today?

    Alternative Splicing in C. elegans

    I am having a hard time understanding the Alternative Splicing that takes place in C. elegans. Can you help? I have read articles on the internet but they don't make sense to me so I was wondering if you can make associations along the way so I can understand. Thanks

    Strain of Aspergillus was subjected to mutagenesis by X rays

    A strain of Aspergillus was subjected to mutagenesis by X rays, and two tryptophan-requiring mutants ( A and B) were isolated. These tryptophan-requiring strains were plated in large numbers to obtain revertants to wild type. You failed to recover any revertants from mutants A and recovered one revertant from mutant B. This r

    Western Blot

    Please see attachment for image. You ran your experiments on a gel and detected the proteins using a Western Blot (again remind yourself how do you make recombinant proteins, generate antibodies, and perform a Western). You results are demonstrated on this gel. The lanes are designated with the letter A-G. Vertical lines are

    Effects of Altered Status/Growth and Development on Disease Processes

    3. Explain why teratogens are difficult to identify. 4. Explain why a woman carrying the gene for hemophilia can produce two hemophiliac sons when she is mated to a normal male. 5. Under what conditions does a female acquire an X-linked recessive disorder? 7. The pedigree for Queen Victoria of England, a carrier

    Genetic Isolation

    If I were to use the scientific method as my framework- How do new species arise by genetic isolation? What would be your observations, questions, hypothesis, predictions, experiment (s) and finally the results in answering this question?

    Mule - Hybrid of Horse & Donkey

    Please see attached file. 1. A stable polyploidy plant species was found that has 26 chromosomes, which form 13 bivalents in meiosis. Is it an autoploid or alloploid? 2. Horses have 64 chromosomes, while donkeys have 62. Hybrids between horses and donkeys are mules, and are sterile. If two mules mated, with each prod

    Oats are allohexaploid with 2N=6X=42

    Please answer in detail. 3. Oats are allohexaploid with 2N=6X=42. How many chromosomes does one of its diploid relatives, Avena barbata, have? 4. Arabidopsis thaliana has 5 pairs of chromosomes, so 2n=2x=10. Answer the following questions about this plant. a. How many chromosomes would an autotetraploid Arabidopsis

    What will be the phenotypes and proportions of the progeny?

    In fruit flies, black body (b) is recessive to gray body (b+), purple eyes (pr) is recessive to red eyes (pr+), and vestigial wings (vg) are recessive to normal wings (vg+). The loci coding for these traits are linked, with the following map distances: b____5_____pr_______5_______vg The interference among these gen

    Restriction enzymes

    In the following sequence find restriction sites for EcoRI, HindIII and Hae III. Show how many fragments will be produced by restriction by all of these enzymes at the same time and their size, Which of the fragments produced will have 5'-overhang, 3'-overhang or blunt end? GAAGAACCTGAATTCAAATTTGGCCCTGCTGCTGAAGCTTGCTGACCAGG

    Digestion and Electrophoresis of DNA in Dogs

    The restriction enzyme Scs1 cuts at a restriction site that is found only very rarely in dog genomes. One dog, Jimmy, has two restriction sites for this restriction enzyme in his genome. Another dog, Billy, has three restriction sites for this enzyme in his genome. For this problem assume there is only one chromosome in dogs.