Today, scientific advances are being made at an astounding rate, and nowhere is this more evident than in our understanding of the biology of heredity. Using DNA as a starting point, do you believe there are limits to the knowledge people should acquire? Defend your answer. Because genetics is important to so many aspects of hu
This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene. AUGUUUGCUGGGGGACAUUCGUGGGCA from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcrib
Suppose the (1) ____ oocyte is on its way down an oviduct when a female and male are engaged in sexual intercourse, or (2) _____. The male sex act requires (3) _____________ and ejaculation. During coitus, pelvic thrusts stimulate the penis, the female's (4) ____________, and the vaginal wall. The mechanical stimulation induces
FSH and (1) _______ stimulate cells outside the zona pellucida to secrete (2) _____. A(n) estrogen-containing fluid accumulates in the follicle, and estrogen levels in the blood begin to increase. About eight to ten hours before being released from the ovary, the (3) _____ completes Meiosis I. And then its (4) _____ divides, for
In addition to protein phosphorylation and dephosphorylation, protein degradation also plays key role in regulating signal transduction pathways and cell proliferation. Please answer the following questions: (1). Please give one example to describe how protein degradation regulates signal transduction pathway; (2) Plea
Why can't a monomeric receptor tyrosine kinase recruit proteins to the receptor? What would happen if the GTP-ASE protein(GAP) were inhibited? EDIT: I have found the answer to the the second question posted here. However, I believe I have discovered the answer to the first question, but I fail to understand it. Can someone
If the G protein alpha subunit has a mutation so that it can't hydrolyze GTP, what happens?. If the G-protein can only bind to GDP how would that effect the pathway? I believe if the alpha subunit has a mutation and cant hydrolyze GTP then the G-protein will be unable to inactivate itself. How will this be bad?
Someone with knowledge about GEF's and GAP's please help me understand what this means. In the regulation of molecular switches, protein kinases and guanine nucleotide exchange factors(GEF's) turn proteins on and protein phosphotases and GTPase activating proteins(GAP's) turn proteins off.
I want to study a human protein(protein X) that is normally secreted from the cell. I express the gene for Protein X in cultured Rat cells. I conduct a pulse-chase experiment in which I specifically label Protein X(and no other cellular protein) at 37 degrees celcius and then perform a 35 minute chase also at 37 degrees celcius
I have a major question about the hereditary genes. Using Mendelian genetics you can determine the likelihood of your eye color, your hair color, some things that fall in these lines, but at the age of 25 I would like to know how I can determine when I will have a head full of white hair. My father has some white hair and my
A man has genotype AA, Bb, cc, DD, ee, FF. what would be the genotypes of any and all sperm he might produce considering all six genes
What phenotypic ratio would be expected in offspring from a cross of Aa CC x aa CC if gene "a" and gene "c" were independent and A = long hair, a = short hair, C = brown coat, and c = white coat
A geneticist determines that long hair length in mink is dominant over short hair (recessive). his friend breeds mink in captivity with long hair esp for the fur inducstry and has received permission from the Kansas Department of Wildlife and Parks to trap 5 wild mink to add to his breeding stock to reduce effects of inbreeding
What would be the expected genotypic and phenotypic ratios in the F1 and F2 generatiosn, if flower color in carnations is controlled by co-dominant alleles and you begin with the P generation using pure, or true-breeding, carnations that have different (red & white) flower colors?
A man who has free earlobes marries a woman who has attached earlobes. What would be the expected phenotypes ( and ratios or percentages) of off spring if the man were homozygous? Assume E= dominant allele for free earlobes and e - recessive allele for attached earlobess. Ideas are included.
What tRNA bases can be attached to the mRNA codon, UGC? Details are included.
In given a polypeptide that is composed of five amino acids: methionine-valine-glutamic acid-lysine-tyrosine. What is the mRNA sequence, the complementary DNA sequence, and the tRNA anticodons of( *See Attached Chart*) Please include the STOP codon.
A) Cross a wildtype female with a yellow bodied male to produce an f1 offspring generation. Which allele is domonant and which is recessive. Justify your responce using your results. b) Now mate F1 individuals to produce an F2 generation. report the results and explain them. Is there evidence of sex linkage. justify your respon
1. Trace the pathway of a sperm from the male testes to the uterine tube of a female. 2. Fertilization involves much more than a mere restoration of the diploid chromosome number. What does the process of fertilization entail on the part of both the egg and sperm? What are the effects of fertilization? 3. Why is the term
Is eukaryotic DNA packaged in the cell in the form of a double helix? Ideas are explained.
We have to attach all of the sources. I am having trouble finding anything but examples and biology teacher notes. I have worked on this for 2 days and only have an opening statement that seems to pretty much sum up everything. I need to avoid unnecessary information but I feel I have limited resources. Can someone please el
29,616 nucleotides are required to make a protein that has 9,872 amino acids. Name 5 enzymes involved in this process.
What are transposons? How are they indentified in a genome? What is the mechanism of transposition?
Bacterial mRNA AUGUUUGCUGGGGGACAUUCGUGGGCA produced the following template strand from which this mRNA was transcribed TACAAACCACCCCCTGTAAGCACCCGT My questiohn is inserted a T at the begining of the sequence to produce TTACAAACGACCCCCTGTAAGCACCCGT what is the new mRNA sequence corresponding with this altered DNA Deletetion of th
In Aspergillus, the genes y (yellow), os (osmotic), c (colonial), leu (leucine-requiring), and a (aconidial) are located on the long arm of chromosome 3. A diploid was made between a haploid wild type and a haploid of genotype y os c leu a. From the green diploid, yellow diploid sectors appeared. When these were sampled and test
How can only four different nucleotides be used to construct a genetic code that will specify 20 different amino acids? These questions are presented.
What is a-complementation and what are some examples of this process?
The Polymerase Chain Reaction (PCR), devised by Kary Mullis in the mid-1980's has revolutionized molecular biology by allowing a whole new approach to the study and analysis of genes. i) What is PCR? ii) What are the steps involved? iii) What are the necessary reagents involved in making the PCR work?
When DNA is replicated in Eukaryotic cells, it gets shorter with each round of division due to the mechanics of DNA replication. How do Eukaryotic cells prevent the loss of important information? How do bacteria cope with this problem? These questions are pondered.
From the sequence below, find probable restriction endonuclease sites. HINT: The recognition sequences are 6bp long. 5' CATTCGGTACCTTCGTGAATTCTGACCAC 3'