Explore BrainMass

Explore BrainMass

    Find probable restriction endonuclease sites

    Not what you're looking for? Search our solutions OR ask your own Custom question.

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    From the sequence below, find probable restriction endonuclease sites.
    HINT: The recognition sequences are 6bp long.

    5' CATTCGGTACCTTCGTGAATTCTGACCAC 3'

    © BrainMass Inc. brainmass.com March 6, 2023, 1:15 pm ad1c9bdddf
    https://brainmass.com/biology/dna-chromosomes-and-genomes/probable-restriction-endonuclease-sites-10929

    Solution Preview

    Remember that restriction enzymes generally recognize palendromic sequences. Palendromic sequences are sequences that read the same on both template and complementary strands. An example of this is: 5' GAATTC 3'. If you take the ...

    Solution Summary

    The expert finds the probable restriction endonuclease sites. The recognition sequence of a coding site is found.

    $2.49

    ADVERTISEMENT