Find probable restriction endonuclease sites
Not what you're looking for? Search our solutions OR ask your own Custom question.
From the sequence below, find probable restriction endonuclease sites.
HINT: The recognition sequences are 6bp long.
5' CATTCGGTACCTTCGTGAATTCTGACCAC 3'
© BrainMass Inc. brainmass.com March 6, 2023, 1:15 pm ad1c9bdddfhttps://brainmass.com/biology/dna-chromosomes-and-genomes/probable-restriction-endonuclease-sites-10929
Solution Preview
Remember that restriction enzymes generally recognize palendromic sequences. Palendromic sequences are sequences that read the same on both template and complementary strands. An example of this is: 5' GAATTC 3'. If you take the ...
Solution Summary
The expert finds the probable restriction endonuclease sites. The recognition sequence of a coding site is found.
$2.49