Share
Explore BrainMass

DNA, Chromosomes and the Genomes

Insertion in DNA

Bacterial mRNA AUGUUUGCUGGGGGACAUUCGUGGGCA produced the following template strand from which this mRNA was transcribed TACAAACCACCCCCTGTAAGCACCCGT My questiohn is inserted a T at the begining of the sequence to produce TTACAAACGACCCCCTGTAAGCACCCGT what is the new mRNA sequence corresponding with this altered DNA Deletetion of th

Likages are explored.

In Aspergillus, the genes y (yellow), os (osmotic), c (colonial), leu (leucine-requiring), and a (aconidial) are located on the long arm of chromosome 3. A diploid was made between a haploid wild type and a haploid of genotype y os c leu a. From the green diploid, yellow diploid sectors appeared. When these were sampled and test

What is the Polymerase Chain Reaction?

The Polymerase Chain Reaction (PCR), devised by Kary Mullis in the mid-1980's has revolutionized molecular biology by allowing a whole new approach to the study and analysis of genes. i) What is PCR? ii) What are the steps involved? iii) What are the necessary reagents involved in making the PCR work?

Genetics punnet square , sex lethal etc

In sheep the polled condition ( hornless ) is controlled by a single gene locus with two alleles. Heterozygous females are polled but heterozygous males have horns. Suppose two Heterozygous sheep were crossed. Refer to attachment for multiple choice questions.

Base composition in Aspergillus niger and TMV are figured.

Analysis of base composition from DNA extraction in Aspergillus niger was seen to contain 37% cytosine. Using this data predict the % of adenine. If the same were detected in Tobacco Mosaic Virus [TMV], will it be possible to predict the % of adenine. This job gives reasons.

Predicting DNA structure

A double stranded DNA virus has 200,000 base pairs. Determine the number of nucleotides present and the total number of complete spirals. How long will this DNA be?

DNA length in human beings

Molecular weight of DNA in an autosome of human beings is 0.5 à? 10 power 12. Determine the number of deoxyribonucleotide pairs in this DNA and calculate the length in both micrometers and inches.

Identifying amino acids produced using fixed proportions of nucleotide residues

A solution containing 80% cytosine and 20% uracil was used to make synthetic RNAs. A bacterial cell free system produced proteins using these mRNAs in the following proportions: a) 4 times as many serine as leucine residues. b) 16 times as many serine residues as phenylalanine residues. c) 16 times as many proline resid

Polypeptide equivalents and their functionality

Convert the following mRNA segments into their polypeptide equivalents; a) 5′ GAAAUGGCAGUUUAC 3′ b) 3′ UUUUCGAGAUGUCAA 5′ c) 5′ AAAACCUAGAACCCA 3′ d) 3′ UGACCAGAUCUACCGAAA 5′

Amino acids and codons

A certain gene consists of 450 nucleotide pairs. The protein product of the gene consists of 150 amino acid residues. How many codons make the 150 residues?

Amino acid number prediction following mRNA sequence

How many different mRNAs would specify the following amino acid sequences - a) met - phe - ser - pro b) ile - arg - phe - leu - ala [use the triplet codon chart to find the number of codons representing the amino acids]

General formula for calculating length of DNA

Suppose 25,000 μm is 1 inch. Enumerate a formula to find the length of a DNA molecule in inches a) if the length is known in μm and b) only the number of nucleotide pairs is given.

Composition of bases in yeast

DNA of a certain species of yeast has thymidilic acid content of 32.6%. If the A/T ratio is 0.97, what is the composition of deoxyadenylic acid?

Prediction of DNA strandedness is achieved.

In one set of Φ X phages the deoxyribonucleotide composition was A = 24.7, T = 32.7, G = 24.1 and C = 18.5. Another set of phages had the following deoxyribonucleotide composition - A = 27.6, T = 27.8, G = 22.3 and C = 22.3. a) Find the A/T, G/C ratio of the 2nd set of phages. b) What is the structure of the phage DNA wit

Probability in drosophila mutation experiment

In a mutation experiment in drosophila, 45 mutations were detected amongst 543 males that received 2500 Roentgens (R) and 67 mutations in 649 males that received 4000R. What is the number of progeny expected in 1000 progeny of males exposed to 6000R?

Predicting triplets in laboratory conditions

Under laboratory conditions, a synthetic polyribonucleiotide was produced using a mixture of A and G with a relative frequency of 5:1 respectively. How would a scientist predict the relative frequencies in which the triplets are expected to form when the ribonucleotides form in a random linear array? Indicate which amino acid(s)

Triplet codons and probability

Find the number of triplet codons feasible from 4 ribonucleotides A, U, G and C containing a) no uracil, b) one or more uracils.

Chromosome number in different body cells

An animal cell has 46 post-mitotic chromosomes in each of its somatic cells. How many chromosomes should be present in the following cells- a) Mature egg, b) 1st polar body, c) Sperm, d) Spermatid, e) Primary spermatocyte, f) Brain cell, g) Secondary oocyte, h) Spermatogonium.

Chi-square testing

Cross between pure red tomato and yellow tomato produced all red F1 progeny. From the F2 progeny of 400 plants, 90 were yellow. Hypothesize that a single pair of allele is involved such that Y- = Red and yy = Yellow. Test this hypothesis using Chi square test.

F2 progeny ratio

In squash, disc shaped fruit is dependent on dominant gene D and elongated fruit on recessive allele d. Yellow color is controlled by dominant gene R and green color by recessive allele r. Draw a cross between the homozygous squash fruits and summarize the expected results of F2.

Crosses in garden pea

Garden pea producing round seeds were crossed with those producing wrinkled seeds. The result was the production of 5474 round seeds and 1850 wrinkled seeds. a) What is the original parental cross? b) Indicate the gamete types c) F1 progeny? d) What result do you expect when F1 is selfed? e) Indicate F1 selfed ga