Explore BrainMass
Share

DNA, Chromosomes and the Genomes

Allostery Enzyme Governor Forms

1) The allostery of an enzyme governor is likely to take two forms. They are? 2) In the process of making a protein, the purpose of an adaptor is to? 3) An allosteric receptor embedded in a cell membrane will change shape only when? 4) When the repair mechanism for DNA fails, the result is a what? 5) In the teloph

Probability Assumptions in Mating Pedigrees

(see diagram in the attached file) Answer the following questions based on the assumption that genotypes BB and Bb have brown eyes, while bb has blue eyes. Filled in the symbols in the pedigrees that represent blue eyes. a) What is the probability that the first child of a mating between II-2 and II-7 would be a blue-eyed

Probability

Answer the following questions based on the assumption that genotypes BB and Bb have brown eyes, while bb has blue eyes. Filled in the symbols in the pedigrees that represent blue eyes. a) What is the probability that the first child of a mating between II-2 and II-7 would be a blue-eyed girl? b) What is the probability th

DNA is discussed in plants and animals

There are a number of natural types of DNA. One is animal DNA, one plant DNA, another bacterial DNA. There are two types of DNA (one in plants and one in animal cells) that are part of cells but are not the main blueprint (not found in the nucleus) for the cell. What are these two types of DNA? Ideas are expressed.

Inverted and Direct Repeat

Imagine that you find a sequence 5' GTTTCA 3' at one end of a transposable element. a) Draw this sequence as an inverted repeat on both ends of the element (filling in the N's in the following format): 5GTTTCA-------------------------------NNNNNN3 3CAAAGT------------------------------NNNNNN5 B) Draw this sequence as a dire

Green fluorescent protein is emphasized.

This job names three DNA features that are necessary to make a green fluorescent protein (GFP) reporter construct and indicates which of these controls the tissues in which GFP will be expressed if the construct is used to make a transgenic mouse.

Genomic Library

You are provided with the following two mouse libraries: - a genomic library in a bacteriophage lambda vector with inserts prepared from muscle cell DNA - a genomic library in a YAC vector with inserts prepared from liver cell DNA. a) Would you expect any differences in the types of DNA sequences represented in the two li

Restriction Sites Total Length of Uncut DNA Molecules

You are attempting to map the restriction sites for Ecor I and BamH I on a circular DNA molecule. After conducting single digests with Ecor I and BamH I as well as a double digest, you obtain the following data: Ecor I BamH I Ecor I + BamH I fragment 1 8000bp 2500 bp

Amplify a Stretch of DNA

You would like to amplify a stretch of DNA with the following sequence using the polymerase chain reaction: 5' GTGTTTAGTGGGCGGTAACCGTTACGTAGGTAATGCT 3' Assume (unrealisitcally) that you will use 5 nucleotide long primers positioned to amplify the entire sequence. a) What are the sequences of the two primers you would use?

Transcripts Gene Expressions

Eukaryotes may regulate gene expression at any number of levels. Imagine that transcripts of gene A are found only in the developing liver and transcripts of gene B are found only in the developing eye. List a general type of cis-regulatory sequence difference that could explain the expression difference between the two genes

Restriction Enzyme DNA

The restriction enzyme ECOR I cuts DNA leaving 5' overhangs, Pst I leaves 3' overhangs after cutting DNA and SMA I leaves blunt ends on the fragments it produces.Indicate wheter DNA ligase can join the following pieces of DNA. a) a fragment of human DNA that was generated by cutting with Ecor I and a plasmid DNA that was also c

Hybridization experiment involving complimentary gene

You cross two true breeding strains of zucchini, one with green fruit and the other with yellow. The F1 plants are all green , but when these are crossed, the F2 plants consists of 9 green and 7 yellow. How many genes are involved in determining the zucchini color? Using your own symbols, designate which genotypes yield green an

Gene linkage

The following cross involving three genes was performed: Aa Bb Cc x aa bb cc, and the phenotypes and number of progeny are shown below. Each pair of alleles exhibits simple dominance and recessiveness. Progeny Phenotype Number of progeny A B C 181 a b c 169 a B

Discussing the RAS Protein

Question: You are given a mutant cell that lacks the GTPase activating protein. What abnormalities would one expect to find in the way that RAS activity responds to extra-cellular signals? Why?

This job features tyrosine kinase.

In a series of experiments, genes that code for mutant forms of a receptor tyrosine kinase are introduced into cells. The cells also express their own normal form of the receptor from their normal gene, although the mutant genes are constructed so that they are expressed at considerably higher concentrations than the normal gen

Corn plants, mutant mouse

7. In corn plants, a dominant allele "I" inhibits kernel color, while the recessive allele "i" permits color when homozygous. At a different locus, the dominant gene "P" causes purple kernel color, while the homozygous recessive genotype pp causes red kernels. If plants heterozygous at both loci are crossed, what will be the ph

The use of DNA techniques in forensic science

In forensic analysis using STR systems, up to 16 different loci can be tested in a single PCR reaction. Why is it important for forensic analysis that each locus being tested is present on a different chromosome? Ideas are justified.

Problem Set

(See attached file for full problem description) --- 1. In the following pedigree, assume no outsiders marrying in carry a disease allele. A. What is the mode of inheritance of this disease? Circle one. (1 point) Autosomal dominant; Autosomal recessive; X-linked dominant; Y-linked; mitochondrial inheritance;

Biology problem

If a man with a red-colorblindness (a sex-linked trait) marries a normal woman, would you expect to see the trait expressed in their children? Diagram the cross below to support your answer:

Biology problem

2.) A line of Drosophila melanogaster with ebony body and sepia eyes (line A) is crossed to a line with tan body and red eyes (line B). The F1 are all tan-bodied, red-eyed, and normal-winged. What proportion of gametes produced by line A have the dominant allele for both loci?_____________ What proportion of the gametes p

New phenotypes

Please help with the following problems. Provide step by step calculations. 1. One form of color blindness in humans is caused by a sex-linked recessive mutant gene (c). A woman with normal color vision (c+) and whose father was also color-blind marries a man of normal vision whose father was also color-blind. What proport

Solving a DNA Problem

Why a defendant's genes should be considered as a factor in the criminal behavior. Why a defendant's genes do not excuse criminal behaivor.

Proposed Genetics Model and Results

1. In peas, the chemical pisatin is associated with defense against parasitic fungi: normal plants are resistant to fungi and contain pisatin. Two pure lines were obtained, both of which lacked pisatin and were highly susceptible to fungal attack Line 1 was from California and line 2 was from Sweden. The lines were investigated

DNA sequence motif that is bound by CBF1

I have 5 sequenced genes, including the punitive promotor region of each gene. All are involved in the cold acclimation process in arabidopsis. Each is expressed only when the temperature falls below a certain point. the specific transcripition factor CBF1 binds somewhere between -200 and -250 of the genes to initiate transcrip

Dominant traits/recessive traits

Pattern baldness in humans is controlled by a single autosomal locus with two alleles (B and B'), but pattern baldness is a sex-influenced phenotype: baldness is dominant in males (BB and BB' males become bald), but recessive in females (only BB females become bald). if a population is in Hardy-Weinberg equilibrium for this lo

Examination of Polygenic Traits

In the future, aliens who have invaded earth are conducting a survey of teenagers. When examining body modifications, they conclude that piercing is a polygenic trait. They reached this conclusion by examining only the number of piercings in a teenager, and the number of piercings in their parents. Why might they conclude that t

AP Biology: Practice Test Review

AP Biology Test Review We are doing a mitosis and meiosis lab. I need help on these concept questions. 1. Why is it more accurate to call mitosis "nuclear replication" rather than "cellular division"? 2. Explain why the whitefish blastula and onion root tip are selected for a study of mitosis. 3. List three major diff