Explore BrainMass

DNA, Chromosomes and the Genomes


A geneticist determines that long hair length in mink is dominant over short hair (recessive). his friend breeds mink in captivity with long hair esp for the fur inducstry and has received permission from the Kansas Department of Wildlife and Parks to trap 5 wild mink to add to his breeding stock to reduce effects of inbreeding

Phenotypes are predicted.

A man who has free earlobes marries a woman who has attached earlobes. What would be the expected phenotypes ( and ratios or percentages) of off spring if the man were homozygous? Assume E= dominant allele for free earlobes and e - recessive allele for attached earlobess. Ideas are included.

DNA Structure & Function

In given a polypeptide that is composed of five amino acids: methionine-valine-glutamic acid-lysine-tyrosine. What is the mRNA sequence, the complementary DNA sequence, and the tRNA anticodons of( *See Attached Chart*) Please include the STOP codon.

Genetic Cross

A) Cross a wildtype female with a yellow bodied male to produce an f1 offspring generation. Which allele is domonant and which is recessive. Justify your responce using your results. b) Now mate F1 individuals to produce an F2 generation. report the results and explain them. Is there evidence of sex linkage. justify your respon

Usefulness of the test cross

We have to attach all of the sources. I am having trouble finding anything but examples and biology teacher notes. I have worked on this for 2 days and only have an opening statement that seems to pretty much sum up everything. I need to avoid unnecessary information but I feel I have limited resources. Can someone please el

Insertion in DNA

Bacterial mRNA AUGUUUGCUGGGGGACAUUCGUGGGCA produced the following template strand from which this mRNA was transcribed TACAAACCACCCCCTGTAAGCACCCGT My questiohn is inserted a T at the begining of the sequence to produce TTACAAACGACCCCCTGTAAGCACCCGT what is the new mRNA sequence corresponding with this altered DNA Deletetion of th

Likages are explored.

In Aspergillus, the genes y (yellow), os (osmotic), c (colonial), leu (leucine-requiring), and a (aconidial) are located on the long arm of chromosome 3. A diploid was made between a haploid wild type and a haploid of genotype y os c leu a. From the green diploid, yellow diploid sectors appeared. When these were sampled and test

What is the Polymerase Chain Reaction?

The Polymerase Chain Reaction (PCR), devised by Kary Mullis in the mid-1980's has revolutionized molecular biology by allowing a whole new approach to the study and analysis of genes. i) What is PCR? ii) What are the steps involved? iii) What are the necessary reagents involved in making the PCR work?

Genetics punnet square , sex lethal etc

In sheep the polled condition ( hornless ) is controlled by a single gene locus with two alleles. Heterozygous females are polled but heterozygous males have horns. Suppose two Heterozygous sheep were crossed. Refer to attachment for multiple choice questions.

Base composition in Aspergillus niger and TMV are figured.

Analysis of base composition from DNA extraction in Aspergillus niger was seen to contain 37% cytosine. Using this data predict the % of adenine. If the same were detected in Tobacco Mosaic Virus [TMV], will it be possible to predict the % of adenine. This job gives reasons.

Predicting DNA structure

A double stranded DNA virus has 200,000 base pairs. Determine the number of nucleotides present and the total number of complete spirals. How long will this DNA be?

DNA length in human beings

Molecular weight of DNA in an autosome of human beings is 0.5 à? 10 power 12. Determine the number of deoxyribonucleotide pairs in this DNA and calculate the length in both micrometers and inches.

Identifying amino acids produced using fixed proportions of nucleotide residues

A solution containing 80% cytosine and 20% uracil was used to make synthetic RNAs. A bacterial cell free system produced proteins using these mRNAs in the following proportions: a) 4 times as many serine as leucine residues. b) 16 times as many serine residues as phenylalanine residues. c) 16 times as many proline resid

Polypeptide equivalents and their functionality

Convert the following mRNA segments into their polypeptide equivalents; a) 5′ GAAAUGGCAGUUUAC 3′ b) 3′ UUUUCGAGAUGUCAA 5′ c) 5′ AAAACCUAGAACCCA 3′ d) 3′ UGACCAGAUCUACCGAAA 5′

Amino acids and codons

A certain gene consists of 450 nucleotide pairs. The protein product of the gene consists of 150 amino acid residues. How many codons make the 150 residues?

Amino acid number prediction following mRNA sequence

How many different mRNAs would specify the following amino acid sequences - a) met - phe - ser - pro b) ile - arg - phe - leu - ala [use the triplet codon chart to find the number of codons representing the amino acids]

General formula for calculating length of DNA

Suppose 25,000 μm is 1 inch. Enumerate a formula to find the length of a DNA molecule in inches a) if the length is known in μm and b) only the number of nucleotide pairs is given.

Composition of bases in yeast

DNA of a certain species of yeast has thymidilic acid content of 32.6%. If the A/T ratio is 0.97, what is the composition of deoxyadenylic acid?

Prediction of DNA strandedness is achieved.

In one set of Φ X phages the deoxyribonucleotide composition was A = 24.7, T = 32.7, G = 24.1 and C = 18.5. Another set of phages had the following deoxyribonucleotide composition - A = 27.6, T = 27.8, G = 22.3 and C = 22.3. a) Find the A/T, G/C ratio of the 2nd set of phages. b) What is the structure of the phage DNA wit