The genotype of F1 individuals in a tetrahybrid cross is AaBbCcDd. Assuming independent assortment of these four genes, what are the probabilities that F2 offspring will have the following genotypes? a)aabbccdd b)AaBbCcDd c)AABBCCDD d)AaBBCcDd e)AaBBCCdd Please help me on tackling problems like this in a systematic wa
I'm totally lost in this subject especially when i have to solve problems using probability for trihybrid. I have of not knowing when to use the Rule of Addition and when to us the rule om Multiplication. I will try to show you what i know and maybe you can help me impron on what i already know. R r R(RR)(Rr) r(r
Question 1: Describe the control of gene expression In the Andalusian fowl, the allele for black feathers (B) is incompletely dominant to that for white feathers (b) and the phenotype of the heterozygote is described as blue. The texture of the feathers is controlled by a second gene locus, silky feathers (f) being recessive
1. Each cell of the human body contains 46 chromosomes. a. How many DNA molecules does this statement represent? b. How many different types of DNA molecules does it represent? 2. DNA is extracted from cells of Neurospora, a fungus that has one set of seven chromosomes; pea, a plant that has two sets of seven chromoso
If there are 20 amino acids commonly found in protiens, how many different dipeptides are there? How many different tripeptides? How many different trinucleotides(remember that nucleotides are the building blocks of DNA+RNA)?How many different single stranded RNA's are composed of 99 nucleotides?
The Planning, Research and Development, Corp. is seeking grant money to continue their investigation on the relationship between DNA and heredity. You want it apply for the grant money to continue your internship research project. You thought it would help your case if you research projects where DNA research is being applied wi
What is meant by the "histone code"? Describe the parts of histones involved, their variations, and their general purpose.
Discuss transcription, including such things as the location in the cell, transcription signals, products, chemical details, and/or the amount of chromosome involved.
I have not clue where to start on this or how to go about it. Apart from its essential role in cellular respiration, the mitochondrion is thought to be implicated in a variety disease states as well as the process of ageing. The mitochondrion contains its own circular DNA molecules (termed mtDNA) which largely encodes for pr
F1 females from a cross of AABBCC to aabbcc were backcrossed to aabbcc males. IN the progeny of this cross there were 150 AaBbCc, 145 aabbcc, 55aabbCc, 52 AaBbcc, 31 aaBbcc, 29 AabbCc, 5 Aabbcc and 3 aaBbCc. Is there evidence of interference? What is the coefficient of coincidence?
Rarely, hens reverse phenotypic (not chromosomal dew late in life and develop into sperm producing males. If such a male were to be mated to a normal female, what sex ratio would be expected among the offspring? (Eggs with no X chromosome do not hatch.)
1) Through a series of experiments with sterilized broth, Louis Pasteur disproved the idea of what? 2) To make a specific protein, ribosomes, a set of twenty strands of tRNA, and a strand of messenger RNA work together in a process called what? 3) The process by which a web-spinning spider makes a "sketch" of a web design
1) The allostery of an enzyme governor is likely to take two forms. They are? 2) In the process of making a protein, the purpose of an adaptor is to? 3) An allosteric receptor embedded in a cell membrane will change shape only when? 4) When the repair mechanism for DNA fails, the result is a what? 5) In the teloph
(see diagram in the attached file) Answer the following questions based on the assumption that genotypes BB and Bb have brown eyes, while bb has blue eyes. Filled in the symbols in the pedigrees that represent blue eyes. a) What is the probability that the first child of a mating between II-2 and II-7 would be a blue-eyed
Answer the following questions based on the assumption that genotypes BB and Bb have brown eyes, while bb has blue eyes. Filled in the symbols in the pedigrees that represent blue eyes. a) What is the probability that the first child of a mating between II-2 and II-7 would be a blue-eyed girl? b) What is the probability th
There are a number of natural types of DNA. One is animal DNA, one plant DNA, another bacterial DNA. There are two types of DNA (one in plants and one in animal cells) that are part of cells but are not the main blueprint (not found in the nucleus) for the cell. What are these two types of DNA? Ideas are expressed.
Imagine that you find a sequence 5' GTTTCA 3' at one end of a transposable element. a) Draw this sequence as an inverted repeat on both ends of the element (filling in the N's in the following format): 5GTTTCA-------------------------------NNNNNN3 3CAAAGT------------------------------NNNNNN5 B) Draw this sequence as a dire
This job names three DNA features that are necessary to make a green fluorescent protein (GFP) reporter construct and indicates which of these controls the tissues in which GFP will be expressed if the construct is used to make a transgenic mouse.
You are provided with the following two mouse libraries: - a genomic library in a bacteriophage lambda vector with inserts prepared from muscle cell DNA - a genomic library in a YAC vector with inserts prepared from liver cell DNA. a) Would you expect any differences in the types of DNA sequences represented in the two li
You are attempting to map the restriction sites for Ecor I and BamH I on a circular DNA molecule. After conducting single digests with Ecor I and BamH I as well as a double digest, you obtain the following data: Ecor I BamH I Ecor I + BamH I fragment 1 8000bp 2500 bp
You would like to amplify a stretch of DNA with the following sequence using the polymerase chain reaction: 5' GTGTTTAGTGGGCGGTAACCGTTACGTAGGTAATGCT 3' Assume (unrealisitcally) that you will use 5 nucleotide long primers positioned to amplify the entire sequence. a) What are the sequences of the two primers you would use?
Eukaryotes may regulate gene expression at any number of levels. Imagine that transcripts of gene A are found only in the developing liver and transcripts of gene B are found only in the developing eye. List a general type of cis-regulatory sequence difference that could explain the expression difference between the two genes
The restriction enzyme ECOR I cuts DNA leaving 5' overhangs, Pst I leaves 3' overhangs after cutting DNA and SMA I leaves blunt ends on the fragments it produces.Indicate wheter DNA ligase can join the following pieces of DNA. a) a fragment of human DNA that was generated by cutting with Ecor I and a plasmid DNA that was also c
You cross two true breeding strains of zucchini, one with green fruit and the other with yellow. The F1 plants are all green , but when these are crossed, the F2 plants consists of 9 green and 7 yellow. How many genes are involved in determining the zucchini color? Using your own symbols, designate which genotypes yield green an
The following cross involving three genes was performed: Aa Bb Cc x aa bb cc, and the phenotypes and number of progeny are shown below. Each pair of alleles exhibits simple dominance and recessiveness. Progeny Phenotype Number of progeny A B C 181 a b c 169 a B
Question: You are given a mutant cell that lacks the GTPase activating protein. What abnormalities would one expect to find in the way that RAS activity responds to extra-cellular signals? Why?
In a series of experiments, genes that code for mutant forms of a receptor tyrosine kinase are introduced into cells. The cells also express their own normal form of the receptor from their normal gene, although the mutant genes are constructed so that they are expressed at considerably higher concentrations than the normal gen
7. In corn plants, a dominant allele "I" inhibits kernel color, while the recessive allele "i" permits color when homozygous. At a different locus, the dominant gene "P" causes purple kernel color, while the homozygous recessive genotype pp causes red kernels. If plants heterozygous at both loci are crossed, what will be the ph
In forensic analysis using STR systems, up to 16 different loci can be tested in a single PCR reaction. Why is it important for forensic analysis that each locus being tested is present on a different chromosome? Ideas are justified.
(See attached file for full problem description) --- 1. In the following pedigree, assume no outsiders marrying in carry a disease allele. A. What is the mode of inheritance of this disease? Circle one. (1 point) Autosomal dominant; Autosomal recessive; X-linked dominant; Y-linked; mitochondrial inheritance;