Purchase Solution

Complimentary Gene

Not what you're looking for?

Ask Custom Question

You cross two true breeding strains of zucchini, one with green fruit and the other with yellow. The F1 plants are all green , but when these are crossed, the F2 plants consists of 9 green and 7 yellow. How many genes are involved in determining the zucchini color? Using your own symbols, designate which genotypes yield green and which yield yellow zucchinis.

Purchase this Solution
Solution Summary

Phenotypic expression in complimentary gene depends upon the availability of two different gene. It modifies typical Mendelian F2 ratio of 9:3:3:1 into 9:7.

Purchase this Solution
Free BrainMass Quizzes
BioChemistry Basics

This Quiz will test your knowledge of the amino acids used in biological systems

The Plant Body

This quiz will test your knowledge of the anatomy of a common plant.

Basic Concepts in Neuroscience

This quiz provides a review of the basic concepts in neuroscience.

Creating a Birth Plan

Preparing for a birth and want to make sure that you're including all the right information? Use this quiz to get on the right track and check your birth plan knowledge!

Feeding Babies

Do you know the science behind feeding babies? Test your knowledge with this quiz.

View More Free Quizzes
Related BrainMass Solutions

  • Gene Interaction

    A, C & R are complimentary and will produce pigments in dominant Conditions (A + C + R = Anthocyanin pigments), absence of any one of the dominant allele will produce non- pigmented form Complimentary gene is interallelic interaction in which metabolic

  • Discussing Short Double Stranded RNA

    GUGCCAGACGCAAUGUUGACUU UUCACGGUCUgCGUUACAACUG A. top strand B. bottom strand How does this dsRNA cause gene suppression? This is the issue we need to understand in order to solve this problem.

  • Recombinant DNA Technology Discussion

    That DNA, because it doesn't have the introns in it anymore is called "complimentary DNA" or cDNA. One of the enzymes used to do this synthesis is called "reverse transcriptase."

  • Gene Cloning, Manipulation, & Applications

    In order to study the function of a gene researchers will clone the gene or, more commonly, the cDNA copy of the gene. cDNA, or complimentary DNA, is a copy in DNA form of the coding region of a gene (without introns).

  • Multiple choice review of basic DNA and genetics topics.

    strand d) DNA double helix with the sequence AAGCTC for one strand and TTCGAG for the complimentary strand e) single DNA strand with the sequence TTCGAG Transcription is making mRNA from DNA.

  • Polypeptide Composed of Five Amino Acids

    C; C to G) 1) UAC (complimentary to codon listed in mRNA sequence, above) 2) AAG (complimentary to codon listed in mRNA sequence, above) 3) GAC (complimentary to codon listed in mRNA sequence, above) 4) CGU (complimentary

  • Complimentary base paring in DNA

    Complimentary base pairing occurs and new strand of DNA is formed. This step is ctalyzes by enzyme DNA polymerase III.

  • Smad transcription factors

    The SMADs regulatory action occurs in the nucleus, where the SMAD complex binds to the complimentary target areas of DNA and subsequently accomplishes the role of controlling the activity of particular genes.

  • Complimentary sequence prediction

    8349 Complimentary sequence prediction A strand of DNA is found to have the sequence 5′ AACGTACGTAC 3′. What is the sequence of the nucleotides on the 3′, 5′ strand?

View More Related Solutions