Share
Explore BrainMass

DNA, Chromosomes and the Genomes

Protein degradation

In addition to protein phosphorylation and dephosphorylation, protein degradation also plays key role in regulating signal transduction pathways and cell proliferation. Please answer the following questions: (1). Please give one example to describe how protein degradation regulates signal transduction pathway; (2) Plea

Monomeric Receptors

Why can't a monomeric receptor tyrosine kinase recruit proteins to the receptor? What would happen if the GTP-ASE protein(GAP) were inhibited? EDIT: I have found the answer to the the second question posted here. However, I believe I have discovered the answer to the first question, but I fail to understand it. Can someone

Molecular switches

Someone with knowledge about GEF's and GAP's please help me understand what this means. In the regulation of molecular switches, protein kinases and guanine nucleotide exchange factors(GEF's) turn proteins on and protein phosphotases and GTPase activating proteins(GAP's) turn proteins off.

Protein Expression and Pulse Chase Analysis

I want to study a human protein(protein X) that is normally secreted from the cell. I express the gene for Protein X in cultured Rat cells. I conduct a pulse-chase experiment in which I specifically label Protein X(and no other cellular protein) at 37 degrees celcius and then perform a 35 minute chase also at 37 degrees celcius

Genetics and Inheritance: White Hair

I have a major question about the hereditary genes. Using Mendelian genetics you can determine the likelihood of your eye color, your hair color, some things that fall in these lines, but at the age of 25 I would like to know how I can determine when I will have a head full of white hair. My father has some white hair and my

Genetics of domestic animals - mink breeding

A geneticist determines that long hair length in mink is dominant over short hair (recessive). his friend breeds mink in captivity with long hair esp for the fur inducstry and has received permission from the Kansas Department of Wildlife and Parks to trap 5 wild mink to add to his breeding stock to reduce effects of inbreeding

Genotypic and phenotypic ratios

What would be the expected genotypic and phenotypic ratios in the F1 and F2 generatiosn, if flower color in carnations is controlled by co-dominant alleles and you begin with the P generation using pure, or true-breeding, carnations that have different (red & white) flower colors?

DNA Structure & Function

In given a polypeptide that is composed of five amino acids: methionine-valine-glutamic acid-lysine-tyrosine. What is the mRNA sequence, the complementary DNA sequence, and the tRNA anticodons of( *See Attached Chart*) Please include the STOP codon.

Genetic Cross Similarities and Differences

A) Cross a wildtype female with a yellow bodied male to produce an f1 offspring generation. Which allele is domonant and which is recessive. Justify your responce using your results. b) Now mate F1 individuals to produce an F2 generation. report the results and explain them. Is there evidence of sex linkage. justify your respon

Description and use of test crosses

We have to attach all of the sources. I am having trouble finding anything but examples and biology teacher notes. I have worked on this for 2 days and only have an opening statement that seems to pretty much sum up everything. I need to avoid unnecessary information but I feel I have limited resources. Can someone please el

Insertion in DNA

Bacterial mRNA AUGUUUGCUGGGGGACAUUCGUGGGCA produced the following template strand from which this mRNA was transcribed TACAAACCACCCCCTGTAAGCACCCGT My questiohn is inserted a T at the begining of the sequence to produce TTACAAACGACCCCCTGTAAGCACCCGT what is the new mRNA sequence corresponding with this altered DNA Deletetion of th

Diagram it on chromosomes linkages

In Aspergillus, the genes y (yellow), os (osmotic), c (colonial), leu (leucine-requiring), and a (aconidial) are located on the long arm of chromosome 3. A diploid was made between a haploid wild type and a haploid of genotype y os c leu a. From the green diploid, yellow diploid sectors appeared. When these were sampled and test

What is the Polymerase Chain Reaction?

The Polymerase Chain Reaction (PCR), devised by Kary Mullis in the mid-1980's has revolutionized molecular biology by allowing a whole new approach to the study and analysis of genes. i) What is PCR? ii) What are the steps involved? iii) What are the necessary reagents involved in making the PCR work?

Eukaryotic cells: Preventing the loss of information

When DNA is replicated in Eukaryotic cells, it gets shorter with each round of division due to the mechanics of DNA replication. How do Eukaryotic cells prevent the loss of important information? How do bacteria cope with this problem? These questions are pondered.

Genetics punnet square, sex lethal etc

In sheep the polled condition ( hornless ) is controlled by a single gene locus with two alleles. Heterozygous females are polled but heterozygous males have horns. Suppose two Heterozygous sheep were crossed. Refer to attachment for multiple choice questions. In sheep the polled condition ( hornless ) is controlled by a sing

Codominance in coat colors of palomino horses

D1 and D2 are a pair of codominant alleles involved in the inheritance of coat colors in horses. Genotypes homozygous for D1 produces chestnut [reddish], heterozygous genotypes palomino [golden color with lighter shade of mane and tail] and homozygous for D2 cremello [almost white]. a) Determine the probable palomino: non-pal

Codominant alleles in coat color of guinea pigs

In guinea pigs yellow coat color is produced by homozygous genotype YY, cream color by heterozygous genotype YW and white by homozygous WW. What would be the genotypic and phenotypic ratio of the progeny of matings between two cream colored pigs?

Predicting DNA structure

A double stranded DNA virus has 200,000 base pairs. Determine the number of nucleotides present and the total number of complete spirals. How long will this DNA be?

Amino acid number prediction following mRNA sequence

How many different mRNAs would specify the following amino acid sequences - a) met - phe - ser - pro b) ile - arg - phe - leu - ala [use the triplet codon chart to find the number of codons representing the amino acids]

General formula for calculating length of DNA

Suppose 25,000 μm is 1 inch. Enumerate a formula to find the length of a DNA molecule in inches a) if the length is known in μm and b) only the number of nucleotide pairs is given.

Composition of bases in yeast

DNA of a certain species of yeast has thymidilic acid content of 32.6%. If the A/T ratio is 0.97, what is the composition of deoxyadenylic acid?

Complimentary sequence prediction

A strand of DNA is found to have the sequence 5′ AACGTACGTAC 3′. What is the sequence of the nucleotides on the 3′, 5′ strand? Determine the sequence of the m-RNA template of the given sequence.

Chromosome number in different body cells

An animal cell has 46 post-mitotic chromosomes in each of its somatic cells. How many chromosomes should be present in the following cells- a) Mature egg, b) 1st polar body, c) Sperm, d) Spermatid, e) Primary spermatocyte, f) Brain cell, g) Secondary oocyte, h) Spermatogonium.

Recessive Epistasis: Phenotypes

A locus in Australian Bearded Dragons is involved in the production of pigment. When heterozygous parents mate, 75% of the progeny are colored and the rest are albino. Another phenotype concerns the specific colors that are expressed such that when two green bearded dragons mate, 2/3 of the progeny are green and the rest are spe

Chi-square testing

Cross between pure red tomato and yellow tomato produced all red F1 progeny. From the F2 progeny of 400 plants, 90 were yellow. Hypothesize that a single pair of allele is involved such that Y- = Red and yy = Yellow. Test this hypothesis using Chi square test.