Share
Explore BrainMass

DNA, Chromosomes and the Genomes

Oats are allohexaploid with 2N=6X=42

Please answer in detail. 3. Oats are allohexaploid with 2N=6X=42. How many chromosomes does one of its diploid relatives, Avena barbata, have? 4. Arabidopsis thaliana has 5 pairs of chromosomes, so 2n=2x=10. Answer the following questions about this plant. a. How many chromosomes would an autotetraploid

What will be the phenotypes and proportions of the progeny?

In fruit flies, black body (b) is recessive to gray body (b+), purple eyes (pr) is recessive to red eyes (pr+), and vestigial wings (vg) are recessive to normal wings (vg+). The loci coding for these traits are linked, with the following map distances: b____5_____pr_______5_______vg The interference among these gen

Restriction enzymes

In the following sequence find restriction sites for EcoRI, HindIII and Hae III. Show how many fragments will be produced by restriction by all of these enzymes at the same time and their size, Which of the fragments produced will have 5'-overhang, 3'-overhang or blunt end? GAAGAACCTGAATTCAAATTTGGCCCTGCTGCTGAAGCTTGCTGACCAGG

Transcription

The human beta-globin polypeptide is 146 amino acids long. How long is the coding portion of the human beta-globin mRNA?

Transcription

1. What sequence of nucleotide pairs in a Drosophila gene will encode the amino acid sequence met-trp-phe-trp-met (reading from the amino terminus to the carboxyl terminus)? 2. A wild type gene contains the trinucleotide-pair sequence: was 5'-GAG-3' changed to:5'-GTG-3' 3'CTC -5' 3'-CAC-5' If the second base

DNA Extraction using a Tomatoe

I need to complete a lab can you tell me what I will see: 1. Describe the appearance of the DNA as it precipitates out of solution. 2. Describe the appearance of the DNA after you have spooled it. 3. Describe the appearance of the DNA after you let it dry.

Amino acids and nitrogen products

Although normal E.coli cells can synthesize all the amino acids, some mutants called amino acid auxotrophs, are unable to synthesize specific amino acids and require the addition of that amino acid to the culture medium for optimal growth. In addition to their role in protein synthesis, specific amino acids are also required in

Affinity Chromatography

Affinity Chromatography. Please follow directions and problems attached in Word Doc 9. Word Doc 2 explains the procedure used. See attached file for full problem description.

Genes

Describe what a "gene" is. Include a definition in addition to information on the structure of a gene & regulatory regions.

Restriction Enzyme HaeIII

How many DNA fragments would be generated and what would be the size of each fragment if the restriction enzyme HaeIII was mixed with the following DNA sequence? 5' ACCGGCATTACGGCCTTACATGGCCATAGCCGGAACATCGT 3' 3' TGGCCGTAATGCCGGAATGTACCGGTATCGGCCTTGTAGCA 5'

What would need to happen to our bodies to live forever (hypothetically)?

What are the physical changes needed in the body that would need to happen in order for our bodies to live forever. Changes such as telomerase activity, collagen flexibility, environmental changes, role of the immune system, DNA repair enzymes: these all come into play. Construct a brief list (not to exceed 100 carefully

Mendel/Punnett Square/Genotypes

Having a problem understanding Mendel's theory, would like help answering these scenario's. Have to write an report based on these questions please help Assume that "S" represents the dominant trait of having long leaves, and "s" represents the recessive short-leafed trait in a plant. In the parental generation, you cross

Structure of DNA

What is the significance of adenine, thymine, guanine, and cytosine in the structure of a DNA molecule? Explain how these four nucleotides bond with each other and other components of DNA. What evidence is there to support that this code carries hereditary instructions? Would like your answers to these questions and

Specificity of Albumin Binding

In this experiment we used electrophoresis to study the binding interactions that occure between serum albumin and two synthetic dyes. The dyes were Bromophenol Blue and Ponceau S. The basis for this procedure was the observation that the free dyes not bound to albumin migrate faster than albumin or dyes bound to albumin. I

Gene Expression

I do not understand the process of gene expression as given on certain cites. Please explain the process of gene expression in prokaryotes.

Genetics problems

3. The urine of some people has a distinctive odor after eating asparagus. This appears to be a recessive trait. If a person with aromatic urine marries a person heterozygous for this trait, what phenotypic and genotypic ratios will their children theoretically exhibit? 4. Cat's tail has 42 chromosomes in each somatic cell.

Describe the process of transcription in eukaryotes.

What is involved in going from genomic DNA to messenger RNA (mRNA)? The transciption process involves the concerted action of several proteins called transcription factors which process the DNA in a multi-step process into mRNA.

Motif finding

Question 2: Motif finding Try a number of motif-finding algorithms covered in the lab, and try different parameters. What good motif can you find from the sequence? Here are some useful hints for the analysis (depends on the software you are using): ? Motif width ~ 13, and search in both strands of the DNA ? Ask each algori

DNA sequencing

Predict Functional Domain of DNA Sequence. See attached file for full problem description.

Ecosystem Services - Biodiversity

What are ecosystem services? How would you respond to the critic who says, "Forests are only good for providing timber"? Support your answer with examples of at least four different ecosystem services offered by forests. Define genetic diversity and explain the importance of genetic diversity for crop plants and livestock. I

Genetics/Meiosis questions

How many types of telophase II products can be formed if a homozygote (AA or aa) is under study? How many types of telophase II products can be formed if a heterozygote (Aa) is under study? How many kinds of gametes can be formed if the genotype is AABB? Make a drawing of this type of cell in Prophase I. Label the chromo

Using Rules of Probability to Solve Genetics Problems

I'm totally lost in this subject especially when i have to solve problems using probability for trihybrid. I have of not knowing when to use the Rule of Addition and when to us the rule om Multiplication. I will try to show you what i know and maybe you can help me impron on what i already know. R r R(RR)(Rr) r(r

Describe the Control of Gene Expression

Question 1: Describe the control of gene expression In the Andalusian fowl, the allele for black feathers (B) is incompletely dominant to that for white feathers (b) and the phenotype of the heterozygote is described as blue. The texture of the feathers is controlled by a second gene locus, silky feathers (f) being recessive

Genetics: DNA and Chromosome Problems

1. Each cell of the human body contains 46 chromosomes. a. How many DNA molecules does this statement represent? b. How many different types of DNA molecules does it represent? 2. DNA is extracted from cells of Neurospora, a fungus that has one set of seven chromosomes; pea, a plant that has two sets of seven chromoso