Purchase Solution

four codons that code for Glycine

Not what you're looking for?

Ask Custom Question

There are four codons that code for Glycine.

How may the choosing/selection of the more prevalent codon/codons used for Gly in algae growing in the Arctic differ from algea that grows in a hot spring?

Purchase this Solution
Solution Summary

The solution examines four codons that code for Glycine.

Solution Preview

The following are the four codons that code for Glycine: GGU, GGC, GGA, GGG.
The algae that ...

Purchase this Solution
Free BrainMass Quizzes
The Transfer of Energy in an Ecosystem

This quiz will assess your knowledge of how energy is transferred in an ecosystem and the different levels of trophic organization.

Feeding Babies

Do you know the science behind feeding babies? Test your knowledge with this quiz.

BIOLOGY

Basics in biology

Understanding the Musculoskeletal system

Introduce and understand basic information how the skeletal system and muscular system work in close concert with one another. And how their interaction between muscle and bone, as they work together to allow us movement.

Basic Immunology Quiz

Intro to immuno quiz. Covers the basics of immunology and recognition of foreign substances by the body.

View More Free Quizzes
Related BrainMass Solutions

  • Predicting triplets in laboratory conditions

    2 (1/6) = 25/216 each AAG  Lysine, AGA  Arginine, GAA  Glutamic acid c) Codons with 1A and 2G = (5/6) (1/6)2 = 5/216 each AGG  Arginine, GAG  Glutamic acid, GGA  Glycine d) Codons with all G - GGG = (1/6)3 = 1/216 GGG  Glycine The triplets

  • Genetics-From genes to protein, mutations.

    The last codon encode the stop codon that is usually signal the stop of the transcript What meaning do these mRNA codons have for protein synthesis? Explanation: The mRNA codons are usually in triplet code that codes for amino acids.

  • Standard Genetic Code

    Here would be a start for determining the amino acid sequence: Proline - Tyrosine - Threonine - Glycine - Asparagine - Tyrosine - etc... b) For the above mRNA sequence, identify the bases that correspond to the Shine-Dalgarno sequence.

  • translate mRNA

    The first codon is GGU so you look for GGU in the chart and find the amino acid Gly which is glycine so glycine is the first amino acid in the protein The second codon is UUC so you look for UUC in the chart and find the amino acid Phe which is phenylalanine

  • Mutations in DNA/RNA, Cystic Fibrosis, and Meiosis

    Question: Using the mRNA that you transcribed above, use the genetic code table to determine the resulting amino acid sequence? Turn this in. What is the significance of the first and last codons?

  • DNA sequence into its RNA equivalent

    Hi, DNA is made up of four nucleotides that get there letter names from the nitrogenous base they have (A is adenine, T for thymine, G for guanine, and C for cytosine).

  • Three nucleotide codon

    380378 Three nucleotide codon Because having each nucleotide code for only one amino acid would allow for only four different amino acids to be incorporated into a protein, it was obvious to researchers that there had to be a conversion between

  • From Genes to Proteins, Mutations

    The last codon encode the stop codon that is usually signal the stop of the transcript What meaning do these mRNA codons have for protein synthesis? Explanation: The mRNA codons are usually in triplet code that codes for amino acids.

  • Genetic Biology Questions

    Since both codons code for the same amino acid, this is a silent mutation. 4e. ATGCGGTTTGAGCCCCTCTTATCGTGG ATGCGGTTTGAGCCCCTCCTTATCGTGG Here, we have an addition of a C which creates a downstream frameshift.

View More Related Solutions