Explore BrainMass
Share

Explore BrainMass

    Restriction enzymes

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    In the following sequence find restriction sites for EcoRI, HindIII and Hae III.
    Show how many fragments will be produced by restriction by all of these enzymes at the same time and their size,
    Which of the fragments produced will have 5'-overhang, 3'-overhang or blunt end?

    GAAGAACCTGAATTCAAATTTGGCCCTGCTGCTGAAGCTTGCTGACCAGGCCAAATTT

    Draw how fragments will look like on the gel - assuming very good separation!

    THANK SO MUCH

    © BrainMass Inc. brainmass.com October 9, 2019, 8:02 pm ad1c9bdddf
    https://brainmass.com/biology/dna-chromosomes-and-genomes/restriction-enzymes-137412

    Solution Preview

    The first thing we need to do is write out the restriction sites for the three enzymes, EcoRI, HindIII, and HaeIII. The * marks the cut site.

    EcoRI G*AATTC

    HindIII A*AGCTT

    HaeIII GG*CC

    As can be seen, EcoRI and HindIII will leave overhangs.

    HaeIII, because it cuts right in the middle of the site on both strands, will leave blunt ends. For detail, here's how it would look if we saw both strands:

    ...GGCC... HaeIII would then cut and look like this: ...GG CC...
    ...CCGG... ...

    $2.19