Restriction enzymes
Not what you're looking for?
In the following sequence find restriction sites for EcoRI, HindIII and Hae III.
Show how many fragments will be produced by restriction by all of these enzymes at the same time and their size,
Which of the fragments produced will have 5'-overhang, 3'-overhang or blunt end?
GAAGAACCTGAATTCAAATTTGGCCCTGCTGCTGAAGCTTGCTGACCAGGCCAAATTT
Draw how fragments will look like on the gel - assuming very good separation!
THANK SO MUCH
Purchase this Solution
Solution Preview
The first thing we need to do is write out the restriction sites for the three enzymes, EcoRI, HindIII, and HaeIII. The * marks the cut site.
EcoRI G*AATTC
HindIII A*AGCTT
HaeIII GG*CC
As can be seen, EcoRI and HindIII will leave overhangs.
HaeIII, because it cuts right in the middle of the site on both strands, will leave blunt ends. For detail, here's how it would look if we saw both strands:
...GGCC... HaeIII would then cut and look like this: ...GG CC...
...CCGG... ...
Purchase this Solution
Free BrainMass Quizzes
Understanding the Musculoskeletal system
Introduce and understand basic information how the skeletal system and muscular system work in close concert with one another. And how their interaction between muscle and bone, as they work together to allow us movement.
The Heart
This quiz test the understanding of the heart and some of its parts. It is important to understand how the heart functions and what makes it function.
Breastfeeding Basics
How much do you know about breastfeeding? Find out with this quiz!
Hemophilia: Fact or Fiction
Do you know the truth about hemophilia? Test your knowledge here.
Basic Immunology Quiz
Intro to immuno quiz. Covers the basics of immunology and recognition of foreign substances by the body.