Share
Explore BrainMass

Restriction enzymes

In the following sequence find restriction sites for EcoRI, HindIII and Hae III.
Show how many fragments will be produced by restriction by all of these enzymes at the same time and their size,
Which of the fragments produced will have 5'-overhang, 3'-overhang or blunt end?

GAAGAACCTGAATTCAAATTTGGCCCTGCTGCTGAAGCTTGCTGACCAGGCCAAATTT

Draw how fragments will look like on the gel - assuming very good separation!

THANK SO MUCH

Solution Preview

The first thing we need to do is write out the restriction sites for the three enzymes, EcoRI, HindIII, and HaeIII. The * marks the cut site.

EcoRI G*AATTC

HindIII A*AGCTT

HaeIII GG*CC

As can be seen, EcoRI and HindIII will leave overhangs.

HaeIII, because it cuts right in the middle of the site on both strands, will leave blunt ends. For detail, here's how it would look if we saw both strands:

...GGCC... HaeIII would then cut and look like this: ...GG CC...
...CCGG... ...

$2.19