Explore BrainMass
Share

Explore BrainMass

    Restriction Enzyme HaeIII

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    How many DNA fragments would be generated and what would be the size of each fragment if the restriction enzyme HaeIII was mixed with the following DNA sequence?

    5' ACCGGCATTACGGCCTTACATGGCCATAGCCGGAACATCGT 3'
    3' TGGCCGTAATGCCGGAATGTACCGGTATCGGCCTTGTAGCA 5'

    © BrainMass Inc. brainmass.com October 9, 2019, 7:44 pm ad1c9bdddf
    https://brainmass.com/biology/dna-chromosomes-and-genomes/restriction-enzyme-haeiii-127495

    Solution Preview

    First, we start by looking up the recognition sequence for HaeIII.

    According to http://www.neb.com/nebecomm/products/productR0108.asp, it cuts right in the middle of 5'-GGCC sequences.

    Therefore, let's look at the sequence in question:

    5' ACCGGCATTACGGCCTTACATGGCCATAGCCGGAACATCGT 3'
    3' ...

    Solution Summary

    Restriction enzymes in Haelll is examined. How many DNA fragments which would be generated and the size of each fragments are determined.

    $2.19