Share
Explore BrainMass

Restriction Enzyme HaeIII

How many DNA fragments would be generated and what would be the size of each fragment if the restriction enzyme HaeIII was mixed with the following DNA sequence?

5' ACCGGCATTACGGCCTTACATGGCCATAGCCGGAACATCGT 3'
3' TGGCCGTAATGCCGGAATGTACCGGTATCGGCCTTGTAGCA 5'

Solution Preview

First, we start by looking up the recognition sequence for HaeIII.

According to http://www.neb.com/nebecomm/products/productR0108.asp, it cuts right in the middle of 5'-GGCC sequences.

Therefore, let's look at the sequence in question:

5' ACCGGCATTACGGCCTTACATGGCCATAGCCGGAACATCGT 3'
3' ...

$2.19