Restriction Enzyme HaeIII
Not what you're looking for?
How many DNA fragments would be generated and what would be the size of each fragment if the restriction enzyme HaeIII was mixed with the following DNA sequence?
5' ACCGGCATTACGGCCTTACATGGCCATAGCCGGAACATCGT 3'
3' TGGCCGTAATGCCGGAATGTACCGGTATCGGCCTTGTAGCA 5'
Purchase this Solution
Solution Summary
Restriction enzymes in Haelll is examined. How many DNA fragments which would be generated and the size of each fragments are determined.
Solution Preview
First, we start by looking up the recognition sequence for HaeIII.
According to http://www.neb.com/nebecomm/products/productR0108.asp, it cuts right in the middle of 5'-GGCC sequences.
Therefore, let's look at the sequence in question:
5' ACCGGCATTACGGCCTTACATGGCCATAGCCGGAACATCGT 3'
3' ...
Purchase this Solution
Free BrainMass Quizzes
Identifying Variables in Science Experiments, Part 2
Using sample experiments, test yourself to see if you can identify independent, dependent, and controlled variables. Identifying variables is key in understanding and developing experiments. The questions are biology related, but this can be applied to any area of science.
Understanding the Musculoskeletal system
Introduce and understand basic information how the skeletal system and muscular system work in close concert with one another. And how their interaction between muscle and bone, as they work together to allow us movement.
How Much Do You Know About Genetic Inheritance?
Most of us studied the basics of dominant and recessive genes at some point. However, genetics are much more complicated than this. How far beyond the basics does your knowledge go?
Biochemistry Basics
A refresher quiz to test your knowledge of basics concepts of biochemistry.
The Plant Body
This quiz will test your knowledge of the anatomy of a common plant.