If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein?
Not what you're looking for?
*5'- ATGCTATCATTGACCTTGAGTTATTAA -3'
1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)
2) If DNA and the G were deleted at the asterisk, how would this affect protein synthesis and the resultant protein? (Hint: think about the code!)
3) What would happen to the reading frame if three bases were inserted/deleted? Why?
Purchase this Solution
Solution Preview
*5'- ATGCTATCATTGACCTTGAGTTATTAA -3'
1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)
Well, it would throw off the entire reading frame. For example, let's assign the inserted base as "N". Now, we've got:
*5'- NATGCTATCATTGACCTTGAGTTATTAA -3'
Therefore, our triplets are:
NAT GCT ...
Purchase this Solution
Free BrainMass Quizzes
Basic Concepts in Neuroscience
This quiz provides a review of the basic concepts in neuroscience.
Infant Development: Sleep
How much do you know about infant sleep? Test your knowledge with this quiz.
Parts of the Brain
This quiz will test your knowledge on different areas of the brain.
Birth 101
Do you know about childbirth? Find out with this quiz.
The Transfer of Energy in an Ecosystem
This quiz will assess your knowledge of how energy is transferred in an ecosystem and the different levels of trophic organization.