Explore BrainMass
Share

Explore BrainMass

    If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein?

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    *5'- ATGCTATCATTGACCTTGAGTTATTAA -3'

    1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)

    2) If DNA and the G were deleted at the asterisk, how would this affect protein synthesis and the resultant protein? (Hint: think about the code!)

    3) What would happen to the reading frame if three bases were inserted/deleted? Why?

    © BrainMass Inc. brainmass.com October 9, 2019, 8:35 pm ad1c9bdddf
    https://brainmass.com/biology/dna-chromosomes-and-genomes/156066

    Solution Preview

    *5'- ATGCTATCATTGACCTTGAGTTATTAA -3'

    1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)

    Well, it would throw off the entire reading frame. For example, let's assign the inserted base as "N". Now, we've got:

    *5'- NATGCTATCATTGACCTTGAGTTATTAA -3'

    Therefore, our triplets are:

    NAT GCT ...

    $2.19