Explore BrainMass

Explore BrainMass

    If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein?

    Not what you're looking for? Search our solutions OR ask your own Custom question.

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    *5'- ATGCTATCATTGACCTTGAGTTATTAA -3'

    1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)

    2) If DNA and the G were deleted at the asterisk, how would this affect protein synthesis and the resultant protein? (Hint: think about the code!)

    3) What would happen to the reading frame if three bases were inserted/deleted? Why?

    © BrainMass Inc. brainmass.com March 4, 2021, 8:16 pm ad1c9bdddf
    https://brainmass.com/biology/dna-chromosomes-and-genomes/156066

    Solution Preview

    *5'- ATGCTATCATTGACCTTGAGTTATTAA -3'

    1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)

    Well, it would throw off the entire reading frame. For example, let's assign the inserted base as "N". Now, we've got:

    *5'- NATGCTATCATTGACCTTGAGTTATTAA -3'

    Therefore, our triplets are:

    NAT GCT ...

    $2.49

    ADVERTISEMENT