Purchase Solution

If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein?

Not what you're looking for?

Ask Custom Question

*5'- ATGCTATCATTGACCTTGAGTTATTAA -3'

1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)

2) If DNA and the G were deleted at the asterisk, how would this affect protein synthesis and the resultant protein? (Hint: think about the code!)

3) What would happen to the reading frame if three bases were inserted/deleted? Why?

Purchase this Solution
Solution Preview

*5'- ATGCTATCATTGACCTTGAGTTATTAA -3'

1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)

Well, it would throw off the entire reading frame. For example, let's assign the inserted base as "N". Now, we've got:

*5'- NATGCTATCATTGACCTTGAGTTATTAA -3'

Therefore, our triplets are:

NAT GCT ...

Purchase this Solution
Free BrainMass Quizzes
Basic Concepts in Neuroscience

This quiz provides a review of the basic concepts in neuroscience.

Infant Development: Sleep

How much do you know about infant sleep? Test your knowledge with this quiz.

Parts of the Brain

This quiz will test your knowledge on different areas of the brain.

Birth 101

Do you know about childbirth? Find out with this quiz.

The Transfer of Energy in an Ecosystem

This quiz will assess your knowledge of how energy is transferred in an ecosystem and the different levels of trophic organization.

View More Free Quizzes
Related BrainMass Solutions

  • Sequencing of DNA or RNA

    v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein?

  • Genes to Protein

    This RNA molecule usually gets edited down quite a bit (splicing out sections called "introns" and adding certain structures to both ends, a "cap" sructure at the beginning, and a "polyA" tail to the end).

  • protein synthesis

    60044 DNA If a double-stranded DNA molecule was 32% cytosine, what would be the % of guanine, adenine, and thymine? which kinds of RNA delivers amino acids to the site of protein synthesis?

  • Questions from microbiology

    In the first step in protein synthesis, the small 30S subunit of the ribosome binds to the mRNA molecule: this contains triplet codon (AUG, or GUG) at which protein synthesis starts.

  • How a protein is made

    187654 How a Protein is Made Discuss/diagram the process from gene to protein. In other words, how do you build a protein based on a sequence of DNA? Thank you! Protein synthesis (from DNA) consists of transcription and translation.

  • cell genetics and genetic information

    DNA is the building block of life, but it was once thought that RNA dominate the world and start the beginning of life. Hence, this led to the RNA world theory. RNA is the molecule that stored information on how to make proteins.

  • Characteristics of DNA and RNA molecules and their function:

    They have a pentose sugar linked to a phosphate group at one end and a nitrogenous base at the other end. They are made up of a number of nucleotides, thus referred to as Polymers of nucleotides.

  • Protein Synthesis by Cells

    This is particularly advantagious in cells that must crank out large numbers of the same protein. If each ribosome had to completely transcribe a protein molecule before another could bind to the mRNA, protein production would be much slower.

  • Effect of point mutation on protein synthesis

    112993 How are these two types of mutations likely to affect the protein coded for by a mutant gene? Assume that protein synthesis always reads along a chromosome three bases at a time to code for each successive amino acid in a protein.

View More Related Solutions