Share
Explore BrainMass

cell genetics and genetic information

1. How do the base pairing relationships of DNA bases account for the uniform width of the double helix?

2. Look at Figure 13.13a-c on page 552 on the textbook. What enables the two DNA polymerase III molecules to act on replication as a unit (i.e., simultaneously replicating the leading and lagging strands) even though they are moving toward opposite ends of their respective templates?

3. Histones are known to be largely basic proteins that are predominantly positively charged. How does this explain their tight association with DNA?

4. What are the two major reasons for the multiple initiation sites for eukaryotic replication?

5. The sequences of a particular set of genes are found by in situ hybridization to be heterochromatic in some cells and euchromatic in cells at different stages of development. Briefly explain how this is possible.

6. Despite the numerous checks present in the cell to prevent the placement of the wrong nucleotide in a replicating DNA, a few mistakes can be made. Why is this beneficial in the long term?

7. Figure 11.12 on page 440 in the textbook, shows a transcriptional unit of rRNA with strands of nascent rRNA getting progressively larger as they get closer to the end of the unit, a structure that looks much like an arrowhead. What is the significance of the space between the two arrowheads shown in the picture?

8. Look again at Figure 11.41 on page 466 in the textbook. Given the similarity in the appearances of puromycin and phenylalanyl-tRNA and the fact that puromycin prevents the elongation of a growing polypeptide by entering the A site instead of phenylalanyl-tRNA, as what kind of inhibitor would it be most likely to be classified?

9. Which step in Figure 11.2 (page 431 in the textbook) is reversed by reverse transcriptase?

10. It makes sense that DNA, the stable genetic material of most organisms, should be sequestered in a specific area of the cell to protect it and prevent it from potential damage. On the other hand, the mRNA, the working copy of the genetic code, is relatively short-lived or unstable. Why is the latter advantageous to the cell?

11. Research over the past 50 years has revealed that RNA has catalytic ability, in addition to its role in protein synthesis. What does this discovery suggest in terms of evolution?

12. You are studying protein synthesis in a cell. You have been able to determine very little about the process but have been able to determine that transcription and translation involving the same mRNA cannot occur at the same time. What kind of cell are you studying?

13. The following mRNA was translated from a person with cancer. Find the same base mutation in the following sequence from a cancer cell. (Hint: Find the start and stop codons and translate the mRNA into protein).
C C C A A A U G G A A C C G G G C A U U C A G G U A A C C U A G C C C
Speculate about the consequences of this point mutation in terms of protein function?

14. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long.
TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT
a) Which strand of DNA is transcribed and in which direction? Show your reasoning.
b) Draw the corresponding mRNA sequence and use the genetic code to derive the amino acid sequence of the 5 amino-acid peptide that is produced.

15.
a) Use the genetic code to complete the following table. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments.
b) Label the 5' and 3' ends of the DNA and RNA, as well as the amino and carboxyl ends of the peptide.

C DNA double helix
T G A
C A U mRNA transcribed
G C A Appropriate tRNA anticodon
Trp Amino acids incorporated into peptide

From Question 32, p. 348, Griffiths, A., Wessler, S., Lewotin, R., and Carrol, S. 2008. Introduction to Genetic Analysis, 9th ed. W.H. Freeman and Company, New York.
From Question 1, p. 346, Griffiths, A., Wessler, S., Lewotin, R., and Carrol, S. 2008. Introduction to Genetic Analysis, 9th ed. W.H. Freeman and Company, New York.

Solution Preview

1. How do the base pairing relationships of DNA bases account for the uniform width of the double helix?

Ans: DNA, the building blocks of life itself, has an intriguing shape called a double helix. The double helix of DNA is form when each nucleotide base on one strand binds with another nucleotide base on the other opposite strand. The base pairing between the nucleotide bases is called complementary base pairing and it is process by a type of binding called hydrogen bond. (1) So for example, adenine binds only to thymine by two hydrogen bonds. While cytosine binds only to guanine by three hydrogen bonds. (1) The adenine and guanine belongs to a group of nucleotide called the purine while cytosine and thymine belong to group of nucleotide called pyrimidines. So the purine bases always bind to the pyrimidine bases. (1)
The reason why the double helix DNA is uniform is because the bonding of the complementary base pair between two nucleotides is not covalent; and that they can be broken apart and rejoined together easily in nature and in vitro. Since the bond is a hydrogen bond and hydrogen bonds are noncovalent bonds; the bond are considered a weak bond that are flexible to move and can be broken apart. The DNA double helix is composed of two antiparallel strands that paired by hydrogen bonds, and can often be "pulled apart like a zipper, either by mechanical force or high temperature". (1) Because of the extreme flexibility and weak strength of the base pairs between the bases, DNA can be easily stretch and reform which accounts for its uniformity across its backbone. In addition, the Watson-Crick base pairs (A-T pairs and G-C pairs) on the backbone of the DNA double helix may both have the same width ("1.085 nm") which mainly may contribute to the uniform width of the DNA itself.(1) Also, the amount of adenine bases are equals to the amount of thymine bases, and the amount of cytosine bases equal to the amount of guanine bases so the base compositions are equal when they pair with each others, which make them uniform in width. (6) Another reason why DNA double helix is uniform is that when adenine binds with thymine, it has the same length as when guanine binds with cytosine. So length of the base pair is the same between each pair of bases, which may also contribute to the uniformity in the double helix. (http://en.wikipedia.org/wiki/DNA, 1)

2. Look at Figure 13.13a-c on page 552 on the textbook. What enables the two DNA polymerase III molecules to act on replication as a unit (i.e., simultaneously replicating the leading and lagging strands) even though they are moving toward opposite ends of their respective templates?

3. Histones are known to be largely basic proteins that are predominantly positively charged. How does this explain their tight association with DNA?

Ans: Simply, the double helix of DNA structure is very highly negative charged due to all the negatively charge phosphates group that reside in the backbone of the DNA. Histones are proteins that wrapped around DNA because they are positively charged, which make them easily wrap around the negatively charged DNA through interactions between the positive charges on histone and the negative charges of DNA. (1) Double stranded DNA loops around 8 histones twice formed nucleosomes, which are the building blocks of chromatin. (1) Coiled of nucleosome that surround DNA can be further condensed to form structure called chromatin. (1) Histones have many arginine and lysine amino acids on them that are positively charge, which make them easily bind to the negatively charged DNA. (1) This binding is based on the principle that opposite charge attract. DNA is highly negatively charged because of the phosphate group of each of their nucleotide bases. (1) This makes them bind to the positively charged histones.(1)

4. What are the two major reasons for the multiple initiation sites for eukaryotic replication?

Ans:
Reason 1: One reasons why eukaryotic have multiple initiation sites of replications is that having multiple origin of replications help to efficiently increase the replication and copy numbers of the larger and more complicated eukaryotic genome. (1) In addition, the multiple sites of replication can prevent the delay in replication of the large eukaryotic genome since eukaryotes cannot afford to delay their large genome from copying vital genes to their offsprings. The eukaryotic genome is very complex and enormous, and having multiple origins of replication will also help to accurately copy ...

Solution Summary

DNA is the basic unit of life. The transcription of DNA to mRNA is the very basic to how genetic material is transcribed into functional protein. This is the translation step in which mRNA will be translated into protein using the 3-codon amino acid on tRNA. The ribosome is the translational machinery that does the translation from mRNA to functional proteins. The basic unit of life is a double helix DNA that followed the Watson-Crick base-pairing rule. The adenine must paired with thymine, whereas the cytosine must paired with guanine. The bases paired by hydrogen bonds. DNA is the building block of life, but it was once thought that RNA dominate the world and start the beginning of life. Hence, this led to the RNA world theory. RNA is the molecule that stored information on how to make proteins. It is proteins that form the functions of life in all species.

$2.19