Share
Explore BrainMass

Genetics

Crossing homozygous plants with differing characteristics

I had to cross a homozygous dominant smooth, yellow seeded plant with a homozygous excessive wrinkled, green seeded plant, and this is what I came up with: A. The P1 genotypes ___YY___ x ___yy__ B. Possible gametes are ___Y___, __Y___, ___y__ and __y___ *Then I had to use the Punnett square and complete the

Cross a homozygous dominant smooth seed

Cross a homozygous dominant smooth seed with a homozygous recessive wrinkled seed *I have to cross a homozygous dominant smooth seed with a homozygous recessive wrinkled seed answering the questions: A. P1 individuals genotypes ____________ x _________ B. Possible gametes *Then I have to use the Punnett square and comp

Genetic Cross problems are worked.

In pigs, there are two loci which can influence skin color, genes A and B. Color ranges from roan (red) to sandy to white. Roan pigs have at least one dominant allele at both loci, sandy pigs have at least one dominant at either (but not both) loci, and white pigs have no dominant alleles. a) Researchers mate a red pig (AABB)

Genetic diversity

What is one way that genetic diversity can be introduced in mitosis?

Need help answering question below

Gene probes cab be labeled for detection with: a) enzymes b) flourescent dyes c) radioisotopes d) all of the choices are correct e) none of the choices are correct

Down syndrome

Down syndrome occurs once in approximately 700 live births. The vast majority of these cases are due to trisomy 21 resulting from a non-disjunction event. In rare cases, Down syndrome is caused by a reciprocal translocation between chromosome 21 and the tip of chromosome 14 (or some other autosome) in the germ line. No genes

Genes

Highly expressed genes have a much greater tendency to lose introns (in evolutionary time scale) than genes expressed at very low levels. What molecular mechanism explains this difference?

Biology of sex is discussed.

I Do males engage in cryptic (hidden) mate choice? Ideas for finding some journal articles and other literature on the topic are included.

Genetics, Chromosomes, DNA, RNA, amino acids, dihybrid, monohybrid cross, homozygous condition, heterozygous condition, test cross, nucleic acids, Eukaryotic ribosomes, mutations, mRNA transcript

Answer questions correctly. (1 A sexually producing organism has 12 chromosomes in each somatic cell, how many chromosomes would you find in the organism's gametes (sperm/egg)? (2) The # of chromosomes in the human white blood cell is? (3) The exchange of genes between pairs of homologous chromosomes is called? (4) The

Mendel Second Genetic Law

Why the proportion 9:3:3:1 in Mendel's Law brakes or is not an absolute true? I need to have a nice and easy example to present to class Is epistasis one of the reasons why the law brakes can you explain to me in easier terms/example how can I present this? Thank you

Punnett Square Explanation and Solving with genetics

2.Punnett square for 2 genes that affect pod shape (inflated or wrinkled) and flower position (on stem or at tip)in garden peas. One gene has alleles for inflated (A) and wrinkled (a) traits, where inflated is dominant. The other gene has alleles for on stem (B) and at tip (b) traits, where on stem is dominant. In a cross betwee

Punnett square help with explaining genetic outcomes

Genetic crosses: explain and complete the following scenarios using Punnett Squares. 1.Punnett square for seed color(yellow or green)of Mendel's peas. Show a cross between 2 parents with yellow seeds, both of which are heterozygous. The square will be used to predict how many offspring with green seeds to expect among a popul

DNA sequencing

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene. AUGUUUGCUGGGGGACAUUCGUGGGCA (a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed. (b) Determine the sequence of amin

System Biology BLASTn Protein Network Cellular Signaling Genetics

1. Perform a BLASTn search with the following sequence but only use 30 of the 50 bases. What was your best match? 5' ATGCT CTGGC CACGG CACTT GCGGA TCCCA TGATC TGTGC ACCTG CGATA 3' 3' TACGA CACCG GTGCC GTGAA CGCCT AGGGT ACTAG ACACG TGGAC GCTAT 5' Look to the right at the "E value" and record this number. Comment on the signif

Gene Expression Systems are figured.

Let's assume that I fould a valuable gene fragment (ex. DNA sequence homology with one of the human myosin II genes) 1. Before I proceed for therapeutic development, How would I know if this gene is actually expressed in humans? What method? 2. Now let's assume it is expressed in human. I wish to express the cDNA corre

It's regarding genotypes and linkages.

A hairy-winged (h) Drosophila female is mated with a yellow-bodied (y), white-eyed (w) male. The F1 are all normal. The F1 progeny are then crossed and the F2 that emerge are Females: Wild-type 757 Hairy 243 Males: Wild-type 390 Hairy 130 Yellow 4 White

Mutation and the experimental evolution of fitness

In a lab experiment we examined the evolutionary effects effects of genetic stress: a harmful recessive mutation (nub E and nub X)that was experimentally introduced into a population of flies hundreds of years ago. The goals were to assess the impact of nub on juvenile fitness, the impact of nub on adult fitness and to assess

Biology Questions

It is a good idea to check the assertion that 1.27 X 10 to the 30th power double-stranded DNA molecules of 100 base pairs each would weigh almost 140,000 tons. Hint: Start by using Avogadro's number (listed below) to determine how many moles of DNA are represented by this large number of base pairs. Assume an average mass of

Methods of forensic DNA profile analysis

More methods of VNTR analysis 1. Which of the following is NOT a part of the methods used in single locus probe analysis of VNTR regions of human DNA? Please explain the right answer. A. DNA extraction B. Restriction endonuclease digestion of DNA C. Gel electrophoresis D. Autoradiography E. Recombinant DNA

Forensic DNA Profile Analysis and VNTR alleles

The analysis of VNTR alleles in forensic DNA profile analysis is based on what common method of molecular biology? A. Cloning B. ELISA C. Immunoblotting D. PCR reactions E. Southern hybridization Provide the correct answer and a brief explanation of why the correct answer is correct. Thank you!

Forensic DNA Fingerprinting and the Variations of VNTR

2. The VNTR alleles analyzed in forensic DNA fingerprinting experiments are highly variable from individual to individual. How do the many VNTR alleles at a single locus differ from each other? A. the number of internal restriction endonuclease cleavage sites for the enzyme HaeIII B. the number of protein coding gene

Biology Problem

A genetic locus that is analyzed in many forensic and paternity testing laboratories is the human leukocyte antigen locus known as HLA-DQ alpha. There are four major alleles at this locus known as 1, 2, 3, and 4. How many different genotypes are possible for these four alleles? A. 8 B. 10 C. 12 D. 16 E. 24 Than

Human Genetics Quiz

Exams are approaching quickly and for review, can you please provide the correct answers for the following multiple-choice quiz on human genetics, along with an explanation of the correct answer. Thank you! BIOLOGY QUIZ: MULTIPLE CHOICE QUESTIONS ON HUMAN GENETICS 1. Red-green color blindness is X-linked in humans. If a

Genotype Biology Question

Irene's daughter is type A and her grandson's is type B+. She does not know the type of either father. She wants to know the possible blood types of the fathers in order for her grandson to be a B+? (a) B or O (b) A, B, AB or O (c) AB or B (d) A or B (e) A, B, or AB

Biology question about blood type

1. A mother wants to know the blood type of her son's father. What blood type would the father be if her son and herself are both type A+. Also, her (the mother's) brother is type 0 and her mom is A+. What blood type can the father be? The father could be: (a) A. A, AB, B, or O (b) Either A or B (c) Either A or O

Biology Question

If the mother of a child is blood type O+ and the child is A-, what blood type would the father be? Does the Rh factor of the child being - (negative) mean that one of the parents has to be negative? Both the parents are Rh - all of the siblings are Rh-as well. Could two Rh- parents give birth to a Rh+ child? and visa versa?

Biology Question

A man has type B blood and a woman has type AB blood. Can they produce a child with type O blood?" Is a type O possible in this situation? A. Possible B. Not possible