Explore BrainMass
Share

Explore BrainMass

    Genetics

    cryptic male choice

    I Do males engage in cryptic (hidden) mate choice? Ideas for finding some journal articles and other literature on the topic are included.

    Genetics, Chromosomes, DNA, RNA

    Answer questions correctly. (1 A sexually producing organism has 12 chromosomes in each somatic cell, how many chromosomes would you find in the organism's gametes (sperm/egg)? (2) The # of chromosomes in the human white blood cell is? (3) The exchange of genes between pairs of homologous chromosomes is called? (4) The

    Mendel Second Genetic Law

    Why the proportion 9:3:3:1 in Mendel's Law brakes or is not an absolute true? I need to have a nice and easy example to present to class Is epistasis one of the reasons why the law brakes can you explain to me in easier terms/example how can I present this? Thank you

    Dihybrid Cross Genotype

    A plant of genotype AB/ab is testcrossed to ab/ab. If the two loci are 10 m.u. apart, what proportion of the progeny will be AB/ab? Please show and explain exactly how the dihybrid cross was done for this problem.

    Punnett Square Explanation and Genetic Answers

    3.Punnett square for eye color in fruit flies for a cross between a white-eyed female and a red-eyed male. Red eye color is dominant. The eye color gene is carried on the X chromosome. The simulation will show what ratio of their off-spring would be white-eyed and red-eyed, and what ratio of each of these would be male and femal

    Punnett Square Explanation and Solving with genetics

    2.Punnett square for 2 genes that affect pod shape (inflated or wrinkled) and flower position (on stem or at tip)in garden peas. One gene has alleles for inflated (A) and wrinkled (a) traits, where inflated is dominant. The other gene has alleles for on stem (B) and at tip (b) traits, where on stem is dominant. In a cross betwee

    Punnett square help with explaining genetic outcomes

    Genetic crosses: explain and complete the following scenarios using Punnett Squares. 1.Punnett square for seed color(yellow or green)of Mendel's peas. Show a cross between 2 parents with yellow seeds, both of which are heterozygous. The square will be used to predict how many offspring with green seeds to expect among a popul

    DNA sequencing

    The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene. AUGUUUGCUGGGGGACAUUCGUGGGCA (a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed. (b) Determine the sequence of amin

    System Biology BLASTn Protein Network Cellular Signaling Genetics

    1. Perform a BLASTn search with the following sequence but only use 30 of the 50 bases. What was your best match? 5' ATGCT CTGGC CACGG CACTT GCGGA TCCCA TGATC TGTGC ACCTG CGATA 3' 3' TACGA CACCG GTGCC GTGAA CGCCT AGGGT ACTAG ACACG TGGAC GCTAT 5' Look to the right at the "E value" and record this number. Comment on the signif

    Gene Expression Systems are figured.

    Let's assume that I fould a valuable gene fragment (ex. DNA sequence homology with one of the human myosin II genes) 1. Before I proceed for therapeutic development, How would I know if this gene is actually expressed in humans? What method? 2. Now let's assume it is expressed in human. I wish to express the cDNA corre

    It's regarding genotypes and linkages.

    A hairy-winged (h) Drosophila female is mated with a yellow-bodied (y), white-eyed (w) male. The F1 are all normal. The F1 progeny are then crossed and the F2 that emerge are Females: Wild-type 757 Hairy 243 Males: Wild-type 390 Hairy 130 Yellow 4 White

    Mutations are pondered.

    A student in a molecular genetics lab is using the SSCP technique to analyze DNA from breast cancer tumours, and has identified five different shifts in fragments of the BARD1 gene. (BARD1 [genbank accession number NM_000465] is a tumour suppressor gene, mutations in which are associated with breast cancer.) Partial sequences fr

    Mutation and the experimental evolution of fitness

    In a lab experiment we examined the evolutionary effects effects of genetic stress: a harmful recessive mutation (nub E and nub X)that was experimentally introduced into a population of flies hundreds of years ago. The goals were to assess the impact of nub on juvenile fitness, the impact of nub on adult fitness and to assess

    Consequences of Genetic Diversity

    Human HLA genes (equivalent to MHC genes in mice) have many alleles, and no two individuals have identical alleles at all gene loci. Which of the following are consequences of this genetic diversity? a) Maximizes the kinds of pathogens that can be recognized and eliminated by an immune response within a population b) Trans

    Simple problems in genetics.

    It is a good idea to check the assertion that 1.27 X 10 to the 30th power double-stranded DNA molecules of 100 base pairs each would weigh almost 140,000 tons. Hint: Start by using Avogadro's number (listed below) to determine how many moles of DNA are represented by this large number of base pairs. Assume an average mass of

    Forensic DNA Profile Analysis

    More methods of VNTR analysis 1. Which of the following is NOT a part of the methods used in single locus probe analysis of VNTR regions of human DNA? Please explain the right answer. A. DNA extraction B. Restriction endonuclease digestion of DNA C. Gel electrophoresis D. Autoradiography E. Recombinant DNA

    Forensic DNA Profile Analysis and VNTR Alleles

    The analysis of VNTR alleles in forensic DNA profile analysis is based on what common method of molecular biology? A. Cloning B. ELISA C. Immunoblotting D. PCR reactions E. Southern hybridization Provide the correct answer and a brief explanation of why the correct answer is correct.

    VNTR Alleles and Forensic DNA Fingerprinting

    2. The VNTR alleles analyzed in forensic DNA fingerprinting experiments are highly variable from individual to individual. How do the many VNTR alleles at a single locus differ from each other? A. the number of internal restriction endonuclease cleavage sites for the enzyme HaeIII B. the number of protein coding gene

    Human Genetics Question

    A genetic locus that is analyzed in many forensic and paternity testing laboratories is the human leukocyte antigen locus known as HLA-DQ alpha. There are four major alleles at this locus known as 1, 2, 3, and 4. How many different genotypes are possible for these four alleles? A. 8 B. 10 C. 12 D. 16 E. 24 Than

    Human Genetics Quiz

    Exams are approaching quickly and for review, can you please provide the correct answers for the following multiple-choice quiz on human genetics, along with an explanation of the correct answer. Thank you! BIOLOGY QUIZ: MULTIPLE CHOICE QUESTIONS ON HUMAN GENETICS 1. Red-green color blindness is X-linked in humans. If a

    Genotype of the Offspring

    Irene's daughter is type A and her grandson's is type B+. She does not know the type of either father. She wants to know the possible blood types of the fathers in order for her grandson to be a B+? (a) B or O (b) A, B, AB or O (c) AB or B (d) A or B (e) A, B, or AB.

    Paternity and Blood Type

    1. A mother wants to know the blood type of her son's father. What blood type would the father be if her son and herself are both type A+. Also, her (the mother's) brother is type 0 and her mom is A+. What blood type can the father be? The father could be: (a) A. A, AB, B, or O (b) Either A or B (c) Either A or O

    Biology Question

    If the mother of a child is blood type O+ and the child is A-, what blood type would the father be? Does the Rh factor of the child being - (negative) mean that one of the parents has to be negative? Both the parents are Rh - all of the siblings are Rh-as well. Could two Rh- parents give birth to a Rh+ child? and visa versa?

    Offspring's Blood Type

    What if the mother is type O+ and the father is A-? What would the offspring's blood type be? The offspring could be: (a) A+, or O+ (b) A-, or O- (c) A+, A-, O+, or O- (d) A+, or O-

    Biology Question

    A man has type B blood and a woman has type AB blood. Can they produce a child with type O blood?" Is a type O possible in this situation? A. Possible B. Not possible

    Molecular Genetics of Prokaryotes.

    1. Which of the following is not part of the lac operon of E. coli? A. genes for inducible enzymes of lactose metabolism B. genes for the repressor, a regulatory protein C. gene for RNA polymerase D. a promoter, the RNA polymerase binding site E. the operator, the repressor binding site 2. (The role of the inducer of t

    Produces a pedigree

    How can i produce a peddigree that has 3 generations and a trait for Handedness what is the predicton of mode of inheritance?

    Conjugational cross/gene order

    Analyze the data in the Table and determine the relative order of the four lac alleles with respect to the flanking pro and ade loci. Partial genetic maps of the chromosomes in an Hfr strain and F- strain are shown below: pro- lac- ade+ pro+ lac- ade- Hfr F- A series of conjugati

    Inefficient missense mutation suppressors

    Hi. Can someone please explain the following answer to me: Q: Do you think that the mutated anticodon ACU (which inserts serine) can suppress a particular missense mutation? A: Yes, the mutated anticodon should insert serine at Trp codons. Thus, some missense mutants that have a Trp replacement in the defective protein mig