Share
Explore BrainMass

Genetics

The Manx Cat and issues of heterozygous for the gene are investigated.

Need help getting started Manx cats are distinctive because they do not have tails, their front legs are shorter than their rear legs and they often travel by hopping. These traits are controlled by a single gene. Manx cats are heterozygous for a dominant allele that causes these traits. Explain what type of of cross is

The Manx cat is the featured subject.

Manx cats are distinctive because they do not have tails, their front legs are shorter than the rear legs, and they often travel by hopping. These traits are are controlled by a single gene. Manx cats are (heterozygous for a dominant allele that causes these traits). Question#1: Explain what type of cross is required to pr

Crossing two plants from the F1 generation in a Punnet square

A homozygous dominant smooth yellow seed plant was crossed with a homozygous recessive wrinkled, green seed plant. The genotype of the F1 plants was SsYy; all the F1 plants were heterozygous smooth, yellow seeded plants. a. What are the possible gametes? ______, _____, _____, _______ and ____, ______, _______, ________ b.

Genetic Cross problems are worked.

In pigs, there are two loci which can influence skin color, genes A and B. Color ranges from roan (red) to sandy to white. Roan pigs have at least one dominant allele at both loci, sandy pigs have at least one dominant at either (but not both) loci, and white pigs have no dominant alleles. a) Researchers mate a red pig (AABB)

Genetic diversity

What is one way that genetic diversity can be introduced in mitosis?

Need help answering question below

Gene probes cab be labeled for detection with: a) enzymes b) flourescent dyes c) radioisotopes d) all of the choices are correct e) none of the choices are correct

Down syndrome

Down syndrome occurs once in approximately 700 live births. The vast majority of these cases are due to trisomy 21 resulting from a non-disjunction event. In rare cases, Down syndrome is caused by a reciprocal translocation between chromosome 21 and the tip of chromosome 14 (or some other autosome) in the germ line. No genes

Genes

Highly expressed genes have a much greater tendency to lose introns (in evolutionary time scale) than genes expressed at very low levels. What molecular mechanism explains this difference?

Biology of sex is discussed.

I Do males engage in cryptic (hidden) mate choice? Ideas for finding some journal articles and other literature on the topic are included.

Genetics, Chromosomes, DNA, RNA, amino acids, dihybrid, monohybrid cross, homozygous condition, heterozygous condition, test cross, nucleic acids, Eukaryotic ribosomes, mutations, mRNA transcript

Answer questions correctly. (1 A sexually producing organism has 12 chromosomes in each somatic cell, how many chromosomes would you find in the organism's gametes (sperm/egg)? (2) The # of chromosomes in the human white blood cell is? (3) The exchange of genes between pairs of homologous chromosomes is called? (4) The

Mendel Second Genetic Law

Why the proportion 9:3:3:1 in Mendel's Law brakes or is not an absolute true? I need to have a nice and easy example to present to class Is epistasis one of the reasons why the law brakes can you explain to me in easier terms/example how can I present this? Thank you

Dihybrid cross

A plant of genotype AB/ab is testcrossed to ab/ab. If the two loci are 10 m.u. apart, what proportion of the progeny will be AB/ab? Please show and explain exactly how the dihybrid cross was done for this problem.

Punnett square explanation and genetic answers

3.Punnett square for eye color in fruit flies for a cross between a white-eyed female and a red-eyed male. Red eye color is dominant. The eye color gene is carried on the X chromosome. The simulation will show what ratio of their off-spring would be white-eyed and red-eyed, and what ratio of each of these would be male and fe

Punnett Square Explanation and Solving with genetics

2.Punnett square for 2 genes that affect pod shape (inflated or wrinkled) and flower position (on stem or at tip)in garden peas. One gene has alleles for inflated (A) and wrinkled (a) traits, where inflated is dominant. The other gene has alleles for on stem (B) and at tip (b) traits, where on stem is dominant. In a cross betwee

Punnett square help with explaining genetic outcomes

Genetic crosses: explain and complete the following scenarios using Punnett Squares. 1.Punnett square for seed color(yellow or green)of Mendel's peas. Show a cross between 2 parents with yellow seeds, both of which are heterozygous. The square will be used to predict how many offspring with green seeds to expect among a popul

DNA sequencing

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene. AUGUUUGCUGGGGGACAUUCGUGGGCA (a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed. (b) Determine the sequence of amin

System Biology BLASTn Protein Network Cellular Signaling Genetics

1. Perform a BLASTn search with the following sequence but only use 30 of the 50 bases. What was your best match? 5' ATGCT CTGGC CACGG CACTT GCGGA TCCCA TGATC TGTGC ACCTG CGATA 3' 3' TACGA CACCG GTGCC GTGAA CGCCT AGGGT ACTAG ACACG TGGAC GCTAT 5' Look to the right at the "E value" and record this number. Comment on the signif

Gene Expression Systems are figured.

Let's assume that I fould a valuable gene fragment (ex. DNA sequence homology with one of the human myosin II genes) 1. Before I proceed for therapeutic development, How would I know if this gene is actually expressed in humans? What method? 2. Now let's assume it is expressed in human. I wish to express the cDNA corre

It's regarding genotypes and linkages.

A hairy-winged (h) Drosophila female is mated with a yellow-bodied (y), white-eyed (w) male. The F1 are all normal. The F1 progeny are then crossed and the F2 that emerge are Females: Wild-type 757 Hairy 243 Males: Wild-type 390 Hairy 130 Yellow 4 White