Explore BrainMass

Explore BrainMass

    DNA sequencing and coding

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    See attached for full problem description

    You are given a genomic DNA from human with unknown function. You suspect this piece of DNA might code for a protein, but you are not sure which of the 6 frames are really coding.

    Which frame is most likely coding?

    Which is the most significant domain match?

    Does this protein have anything to do with cancer?

    How about cell differentiation?

    How about viral nucleic acid binding?

    What chromosome is this DNA located?

    What kind of cells express this DNA and make its coded protein?

    © BrainMass Inc. brainmass.com October 9, 2019, 6:53 pm ad1c9bdddf


    Solution Preview

    For the first step, you need to copy the DNA sequence on the bottom of the page and go to the website listed for expasy. You paste your DNA sequence into the box and click on TRANSLATE SEQUENCE (I like the Compact format). This gives you the six different reading frames translated for your DNA sequence with 3 frames coming from each strand. It's important to understand why there are these 6 options. Remember that each amino acid in a protein is coded by 3 nucleotides, but you can start at any spot in the sequence.

    As an example, your sequence starts with TTCTTTTCTAAGCAAACTTT

    You could make this TTC TTT TCT AAG CAA ACT TT


    Even though these three options all have the exact same DNA sequence, you can see that they can be grouped differently into various combinations for amino acids. Every 3-letter combination will give you a specific amino acid.

    So ...

    Solution Summary

    The solution analyzes a given sequence of DNA and finds the implications of it.
