DNA sequencing and coding
Not what you're looking for?
See attached for full problem description
You are given a genomic DNA from human with unknown function. You suspect this piece of DNA might code for a protein, but you are not sure which of the 6 frames are really coding.
Which frame is most likely coding?
Which is the most significant domain match?
Does this protein have anything to do with cancer?
How about cell differentiation?
How about viral nucleic acid binding?
What chromosome is this DNA located?
What kind of cells express this DNA and make its coded protein?
Purchase this Solution
Solution Summary
The solution analyzes a given sequence of DNA and finds the implications of it.
Solution Preview
For the first step, you need to copy the DNA sequence on the bottom of the page and go to the website listed for expasy. You paste your DNA sequence into the box and click on TRANSLATE SEQUENCE (I like the Compact format). This gives you the six different reading frames translated for your DNA sequence with 3 frames coming from each strand. It's important to understand why there are these 6 options. Remember that each amino acid in a protein is coded by 3 nucleotides, but you can start at any spot in the sequence.
As an example, your sequence starts with TTCTTTTCTAAGCAAACTTT
You could make this TTC TTT TCT AAG CAA ACT TT
or T TCT TTT CTA AGC AAA CTT T
or TT CTT TTC TAA GCA AAC TTT
Even though these three options all have the exact same DNA sequence, you can see that they can be grouped differently into various combinations for amino acids. Every 3-letter combination will give you a specific amino acid.
So ...
Purchase this Solution
Free BrainMass Quizzes
Basic Concepts in Neuroscience
This quiz provides a review of the basic concepts in neuroscience.
How Well Do You Know Your Body?
This quiz will assess the different systems of the human body. It will examine everything from the organs to the cellular processes that occur.
Bacterial Genetics
This quiz test your knowledge of the genetics of bacteria.
Creating a Birth Plan
Preparing for a birth and want to make sure that you're including all the right information? Use this quiz to get on the right track and check your birth plan knowledge!
Biochemistry Basics
A refresher quiz to test your knowledge of basics concepts of biochemistry.