Purchase Solution

DNA and mRNA

Not what you're looking for?

Ask Custom Question

What tripeptide would be synthesized from the informational strand of DNA with the sequence 5' GTATCCAGT?

The beta-chain of hemoglobin is a protein that contains 146 amino acid residues. What minimunm number of nucleotides must be present in a strand of mRNA that is coded for this protein?

Purchase this Solution
Solution Summary

Two DNA questons are explained.

Solution Preview

If the informational strand of DNA is 5' GTATCCAGT, then the mRNA synthesized off of the other complimentary template strand would be 5'-GUAUCCAGU.

Therefore, the codons are GUA, UCC and ...

Purchase this Solution
Free BrainMass Quizzes
General Chemistry - Classification of Matter

This test will assess your knowledge on the classification of matter which includes elements, compounds and mixtures.

Organic Chemistry Naming: Alkanes

This is a quiz which is designed to assist students with learning the nomenclature used to identify organic compounds. This quiz focuses on the organic compounds called Alkanes.

Periodic table

Functional groups in Organic Chemistry

You will be tested on the names of functional groups in Organic Chemistry. It is very important to know the functional groups to understand Organic reactions.

Thermochemistry

The quiz helps in revising basic concepts about thermochemistry.

View More Free Quizzes
Related BrainMass Solutions

  • Translation: How to determine an amino acid from mRNA.

    A codon is a three nucleotide sequence from DNA. mRNA is transcribed from DNA, where C (cytosine) nucleotides pair with G (guanine) nucleotides and A (adenine) nucleotides pair with U (uracil) nucleotides (Thymine, or T is in DNA, while U, uracil, replaces

  • DNA strand

    The DNA strand from which the mRNA is transcribed is opposite in polarity and sense to the mRNA, thus making it "anti-sense" or the minus strand. 5'- AUGUAUGAGAAUCCCCGGUAA -3' cloned mRNA transcript 5'- ATGTATGAGAATCCCCGGUAA -3' sense DNA Strand

  • DNA Sequences: Separate the Codons Into Triplets

    DNA molecule #1 TAC CGG ATG CCA GAT CAA ATC mRNA #1: ___________________________ DNA molecule #2 TAC GGG GGC GTA ACC ACA ACT mRNA #2 __________________________ DNA molecule #3 TAC CTG

  • Nucleic Acids and the Genetic Material

    DNA template for mRNA synthesis You have obtained a sample of DNA, and you transcribe mRNA from this DNA and purify it. You then separate the two strands of the DNA and analyze the base composition of each strand and of the mRNA.

  • How is mRNA formed from DNA?

    493291 How is mRNA formed from DNA? How is mRNA formed from DNA? DNA provides instructions for the formation of RNA by a process called "transcription." The DNA molecule acts as a template for the RNA molecule.

  • Creating a Recombinant Microorganism

    Describe the process of transcription (how mRNA is made from DNA) and describe how translation changes mRNA into proteins.

  • DNA code to Amino Acid

    Transcription is the synthesis of mRNA from a DNA template. (1) DNA unwinds. (2) RNA polymerase recognizes a specific base sequence in the DNA called a promoter and binds to it.

  • How a protein is made

    In other words, how do you build a protein based on a sequence of DNA? Thank you! Protein synthesis (from DNA) consists of transcription and translation. TRANSCRIPTION is the copying of the DNA molecule by messenger RNA (mRNA).

  • complementary base pairing in DNA

    Write the base sequence for the mRNA that would be formed during transcription from the DNA template strand with the base sequence 5' CGGATATTG 3' . Remember, DNA and RNA strands are written from the 5' to the 3' end.

  • DNA Synthesis and RNA Transcription

    Three main types of RNA: mRNA - mRNA transcribes the genetic code from DNA into a form that can be read and used to make proteins. mRNA carries genetic information from nucleus to the cytoplasm of a cell.

View More Related Solutions