Purchase Solution

mRNA

Not what you're looking for?

Ask Custom Question

Please help with the following problem.

You perform three microarray experiments in which you measure the mRNA levels in Rb mutant cell line (RB triangle) and in a control cell line (wild-type). The background subtracted. Normalized microarray data for three genes are given below.

Please see the attached MS Word document for the chart.

a. Floor the data to 50. Calculate the average ratio (Rb triangle / wt) of the floored data fro each gene, and write the average ratios below. Which genes are differentially expressed if we use an average ratio threshold of a 2-fold increase or decrease in mRNA levels?

b. Which statistical method would work best in identifying differentially expressed genes in this data set? Write the name of the method below.

Attachments
Purchase this Solution
Solution Summary

The following posting helps with problems involving mRNA and microarray experiments. Step by step calculations are given.

Solution Preview

a. Bcl-2: 20/145; 29/157, 38/143,
The average is (20/145+29/157+38/143)/3 = 0.196126
PGK-1: 3714/4508; 3451/4894; 3328/3947
The average is ...

Purchase this Solution
Free BrainMass Quizzes
Cellular Respiration

This quiz is a review for cellular respiration.

Do You Know Your Macromolecules?

This quiz will assess your knowledge of the macromolecules that are important to living things.

Pregnancy Knowledge

How much do you know about being pregnant? Test your Pregnancy IQ with this quiz!

Basic Immunology Quiz

Intro to immuno quiz. Covers the basics of immunology and recognition of foreign substances by the body.

The Transfer of Energy in an Ecosystem

This quiz will assess your knowledge of how energy is transferred in an ecosystem and the different levels of trophic organization.

View More Free Quizzes
Related BrainMass Solutions

  • Determine tRNA anticodon sequences from mRNA sequences.

    mRNA #1: AUG GCC UAC GGU CUA GUU UAG Anticodons for mRNA #1: ______________________________________ mRNA #2 AUG CCC CCG CAU UGG UGU UGA Anticodons for mRNA #2: ______________________________________ mRNA

  • The Difference between Eukkaryotic and Prokaryotic mRNA

    Because prokaryotic mRNA requires neither splicing nor transport, the mRNA can be directly translated while the mRNA is being transcribed, a process called cotranslational transcription.

  • Translation: How to determine an amino acid from mRNA.

    T in RNA). mRNA is made opposite to DNA, so a TTC DNA sequence is equivalent to a AAG mRNA sequence.

  • Polypeptide Composed of Five Amino Acids

    mRNA sequence, above) 4) CGT (complimentary to codon listed in mRNA sequence, above) 5) CTT or GTC or GCT (complimentary to codon listed in mRNA sequence, above) t-RNA Anticodons* (Must compliment mRNA strand- U to A; A to U; G to

  • What do ribosomes do during protein synthesis?

    attach to the mRNA molecule and travel along its length b. attach to the DNA molecule and travel along its length to produce an mRNA molecule c. translate mRNA to tRNA d. transcribe mRNA to tRNA e.

  • mRNA analysis in the lab

    4886 MRNA analysis Describe 3 ways of measuring changes in mRNA expression and provide an explanation of how each one works. Does the method measure mRNA synthesis, degradation, or levels? 1.

  • DNA strand

    The DNA strand from which the mRNA is transcribed is opposite in polarity and sense to the mRNA, thus making it "anti-sense" or the minus strand. 5'- AUGUAUGAGAAUCCCCGGUAA -3' cloned mRNA transcript 5'- ATGTATGAGAATCCCCGGUAA -3' sense DNA Strand

  • DNA code to Amino Acid

    The mRNA produced is called a mRNA transcript. In eukaryotic cells, the newly-formed mRNA transcript (also called heterogeneous nuclear RNA or hnRNA) must be further modified before it can be used.

  • Protein Synthesis and the Effects of Treating a Cell with RNAase

    From these, keeping one strand as a copy, mRNA generates a template for transcription. The mRNA moves from the nucleus where it is synthesized to the cytoplasm where translation of mRNA into a protein is accomplished via genetic code reading.

  • Gene expression in prokaryotes

    Gene expression in simple terms is transcription of DNA (stretch of genes) to mRNA and subsequent translation of mRNA to proteins which are required in different metabolic functions of the organism.

View More Related Solutions