DNA code

Related BrainMass Solutions

• Question about DNA code

  111696 Question about DNA code DNA code = T A C T T A C C G A G A T T C T T G T T T A T C mRNA code = Using the provided DNA code, derive the correct amino acid sequence.

• Amino Acid Sequence in a Protein Molecule

  For example, the amino acid Met has genetic code AUG, whereas the amino acid Lys has genetic code AAA or AAG. Because there is more than one code for most amino acids, for simplicity, I'm writing one example only.

• Sequencing of DNA or RNA

  DNA, mRNA and the Genetic Code We have the following single strand of nucleic acid: 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' i) Is this a strand of DNA or RNA? How do you know?

• What is the histone code?

  Charges on the amino acids arginine and lysine cause the DNA to wrap around the octomer. A "tails" is left sticking out of the neucleosome. (The nucleosome consists of the octomer and DNA wrapped around twice).

• DNA code to Amino Acid

  135404 DNA Code Using the provided DNA code, derive the correct amino acid sequence. Describe the necessary steps to arrive at the amino acid sequence, and explain each in detail.

• DNA to protein and the impact of mutations

  The mutation will still code for a K (Lysine) Hope this helps, Detailed answer to the questions are provided.

• Transmission of Genetic Material

  The strand of mRNA attaches to the DNA, getting the code. For example, if the strand of DNA read TTAGCCTA then the mRNA strand would be AAUCGGAU. The mRNA then takes the code and leaves the nucleus.

• If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein?

  *5'- ATGCTATCATTGACCTTGAGTTATTAA -3' 1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)

• Diagram of DNA transcription through RNA translation.

  DNA transcription 2. mRNA translation 3. The genetic code. The diagram is color-coded, labeled, and in MS Word format for easy downloading. This is a great question!