Purchase Solution

Rules for sequence

Not what you're looking for?

Ask Custom Question

Find the rule for the sequence below.

square 2x2 =10
3x3=40 +30=20 difference
4x4=90+50=20 difference
5x5=160+70=20 difference

Purchase this Solution
Solution Summary

This shows how to find a rule for a given sequence. The square differences are given.

Purchase this Solution
Free BrainMass Quizzes
Probability Quiz

Some questions on probability

Exponential Expressions

In this quiz, you will have a chance to practice basic terminology of exponential expressions and how to evaluate them.

Geometry - Real Life Application Problems

Understanding of how geometry applies to in real-world contexts

Multiplying Complex Numbers

This is a short quiz to check your understanding of multiplication of complex numbers in rectangular form.

Solving quadratic inequalities

This quiz test you on how well you are familiar with solving quadratic inequalities.

View More Free Quizzes
Related BrainMass Solutions

  • Human Biology - mRNA

    AUGUUUGCUGGGGGACAUUCGUGGGCA from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed. Determine the sequence of amino acids coded for by this mRNA.

  • Concise summary of Central Dogma with example

    simply copy the original DNA sequence given, this time making sure to substitute U (uracil) for thymine (T).

  • Bacterial mRNA

    22113 Bacterial mRNA This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene.

  • Question about DNA code

    What are the necessary steps to arrive at the amino acid sequence in detail. What is the mRNA sequence, and the amino acid sequence?? In order to solve this problem, we must understand basic base pairing rules in nucleic acids.

  • Sequencing of DNA or RNA

    Response: To determine the mRNA sequence, we must use the base pairing rules from above except substitute U for T. Therefore, GC and AU.

  • Operations Management Problem

    to achieve different objectives as listed below, and provide a rationale for each of the responses: question First, we use the different scheduling rules and calculate the various performance for that rule.

  • Johnson's rule - Rank the Critical ratio sequencing rules

    217201 Scheduling See attached for proper formatting Rank the Critical ratio sequencing rules on the three evaluation criteria of average flow time, average number of jobs in the system, and average job lateness for the information below.

  • Emile's Inheritance

    Find closed-form rules for f(n) and g(n). b. For what values of n is f(n) < g(n). c. For what values of n is f(n) > g(n). a. Option 1 is the following sequence: 10 000 11 000 12 000 And so on.

  • DNA sequence into its RNA equivalent

    The pairing rules of DNA to RNA is that A always pairs with U, T pairs with A, C pairs with G, and G pairs with C.

  • DNA strand

    The classic base pairing rules are simple: guanine pairs with cytosine (G:C), and uracil/thymine pairs with adenine (U/T:A), thus the strand of DNA that serves as the template for the mRNA is easily determined.

View More Related Solutions