Explore BrainMass

Explore BrainMass

    Bacterial Genetics and Replication

    Not what you're looking for? Search our solutions OR ask your own Custom question.

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    1. See the attached file for a diagram of DNA that can serve as template for replication. Label the origin. Using a circle to represent the polymerase, diagram the leading and lagging strands, indicating the direction of synthesis. Be sure to completely label the new DNA.

    2. You have 2 tubes containing cultures of genetically distinct bacterial strains. You know that when you mix the two together, you get Horizontal gene transfer (HGT), but you do not know what genetic exchange mechanism is accomplishing this transfer. Prior to mixing the strains, you add an enzyme that degrades any DNA it comes into contact with the tubes and allow it to incubate briefly. You then mix contents of both tubes together and find that you are no longer able to achieve HGT. Both cultures are still completely viable. Name the 3 methods of HGT that we discussed in class. Which of these is the MOST likely process you interfered with? In your answer, explain your observations and why the other two processes are not likely to be involved.

    3. Below is a sequence of double stranded DNA from a bacterium. Based on what you know about bacterial transcription and translation, put an "X" next to the strand that is most likely to be the template strand for transcription and give a brief answer for your choice (5-10 words). Then,
    clearly underline the likely coding sequence
    transcribe it into mRNA
    C) translate this into protein using the genetic code table.

    © BrainMass Inc. brainmass.com December 24, 2021, 11:12 pm ad1c9bdddf
    https://brainmass.com/biology/genetics-of-bacteria/bacterial-genetics-replication-547695

    Attachments

    SOLUTION This solution is FREE courtesy of BrainMass!

    Section A: General Bacterial Genetics
    1. See the attached file for a diagram of DNA that can serve as template for replication. Label the origin. Using a circle to represent the polymerase, diagram the leading and lagging strands, indicating the direction of synthesis. Be sure to completely label the new DNA.

    Origin of replicationn- bacteria have only one origin of replication. (1) DNA replication occur in a bidirectional direction from the origin of replication.(1) Starting from the origin of replication, replication proceeds in opposite directions away from origin. (1) Two replication forks from each origin of replication occur because replication is bi-directional. (1) The open area of chromosome between replication forks is called replication bubble.
    DNA polymerases catalyzed DNA replication. (1) DNA polymerase synthesize DNA only in the 5' to 3' direction. (1) DNA pol I need a primer to initiate DNA replication. (1) A primer is a preexisting nucleic acid that initiate DNA synthesis. (1) DNA polymerase need to add nucleotide to the 3' end free hydroxyl group. (1) DNA polymeras II and III are the main polymerase for DNA replication. (1) DNA pol I is mainly involve in DNA repair. (1)

    DNA pol III start to add nucleotide to the new DNA strand. As the replication fork unwind, synthesis of one strand ( lower strand) continue following the replication fork. (1) The other strand cannot continue to move along, but leave a gap behind. A second RNA primer is needed to complete the DNA synthesis. (1) Thus, at each replication fork, the synthesis of new DNA strand ( lower strand) is continuous, while the synthesis of the other strand is discontinuous. (1) The strand of DNA that is synthesize continuously is the leading strand and the discontinuous synthesized strand is the lagging strand. (1) Small fragments of DNA of the lagging strand are called Okazaki fragments.(1)

    2. You have 2 tubes containing cultures of genetically distinct bacterial strains. You know that when you mix the two together, you get Horizontal gene transfer (HGT), but you do not know what genetic exchange mechanism is accomplishing this transfer. Prior to mixing the strains, you add an enzyme that degrades any DNA it comes into contact with the tubes and allow it to incubate briefly. You then mix contents of both tubes together and find that you are no longer able to achieve HGT. Both cultures are still completely viable. Name the 3 methods of HGT that we discussed in class. Which of these is the MOST likely process you interfered with? In your answer, explain your observations and why the other two processes are not likely to be involved.

    Horizontal gene transfer is the process of acquiring DNA sequences from one bacterium to another bacterium that enables bacteria to respond and adapt to their environment. (2) It is also know as lateral gene transfer in which " an organism transfers genetic material to another organism that is not its offspring." (2) The HGT enable Bacteria and Archae to adapt to new environment. HGT is part of the bacterial evolution. (2)
    There are three mechanisms of HGT in bacteria:
    1. Transformation - process of genetic recombination in which a DNA fragment from a dead, bacterium enters a competent recipient bacterium and exchanged for piece of DNA of recipient. (2)
    2. Transduction - the transfer of DNA fragment from one bacterium to another by bacteriophage(2)
    3. Conjugation- genetic recombination in which there is a transfer of DNA from a living donor bacterium to a living recipient bacterium by cell to cell contact. It usually involves a donor bacterium that contains conjugative plasmid and recipient cell that does not. (2)

    Transformation is not likely to be involve in the Horizontal Gene Transfer of the two mix strains of bacteria. Transformation involve the transfer of a DNA fragment from a dead, degraded bacterium into a competent live recipient bacterium. (2) It usually involves only homologous recombination after the DNA from dead bacterium enter the recipient bacterium. (2) Since homologous recombination involve homologous DNA regions of the same bases, transformation must require similar bacterial strains of the same species. (2) In the experiment above, the two strains of bacterial are genetically distinct and unrelated. Another explanation why transformation is not the HGT here is that the two strains are viable. (2) Transformation is the transfer of DNA from a dead, degraded bacterium to a live recipient bacterium. (2)

    Transduction is also rule out here because the experiment does not involve the use of a bacteriophage to transfer DNA fragment from one bacterium to another bacterium. (2) The use of the bacteriophage for the transfer of DNA from one bacterium to another is the sole definition of transduction. (2) There are no bacteriophage mentioned in the experiment. We are just mixing the two strains together for HGT to occur. (2)

    The most likely HGT process is conjugation because we are dealing with two viable, living bacterium in which we mix them together to allow the conjugation to occur. Recalled that conjugation is the genetic recombination that occurred when there is a "transfer of DNA from a living donor bacterium to a living recipient bacterium by cell-to-cell contact." (2) Well, by mixing the two strains together,we are introducing cell-to-cell contact. I believed that this conjugation involve a donor bacterium that contain a "conjugative plasmids" and a recipient bacterium that does not. (2) A " conjugative plasmid contains all the genes necessary for the plasmid to transmit itself to another bacterium by conjugation." (2) If the enzyme was introduce into the bacterial strain that degrade any DNA, that enzyme may have degrade the conjugative plasmid DNA in one of the strains when introduce into the two test tubes contain each strain. (2) As a result, there was no HGT because the enzyme had degraded the conjugative plasmid necessary for conjugation. The two strains were still viable because the enzyme only degrade the conjugative plasmids, not the whole bacteria genome.

    3. (5pnts) Below is a sequence of double stranded DNA from a bacterium. Based on what you know about bacterial transcription and translation, put an "X" next to the strand that is most likely to be the template strand for transcription and give a brief answer for your choice (5-10 words). Then,
    A) clearly underline the likely coding sequence
    B) transcribe it into mRNA
    C) translate this into protein using the genetic code table.

    X
    Template strand
    3'TAATTTCGCTACCTTAAACGGTTATGACGGAGTTGATAGACGACT 5'

    DNA polymerases synthesize DNA only in a 5' to 3' direction, and it must add new nucleotide to free 3'OH group of the growing DNA strand. (1) The new DNA strand must grow in the 5' to 3' direction, and the template strand must be the bottom antisense strand starting at the 3'  5'. (1) The new strand must be 5 -> 3' direction. (1)

    Template strand
    3'TAATTTCGCTACCTTAAACGGTTATGACGGAGTTGATAGACGACT 5'

    New complementary strand
    5' AGGAAAGCGATGGAATTTGCCAATACTGCCTCAACTATCTGCTGA 3'

    Trancription into mRNA
    5'UCC UUU CGC UAC CUU AAA CGG UUA UGA CGG AGU UGA UAG ACG ACU 3'

    Translate into proteins
    S--- F ---R----Y-----L-----K----R----Stop Stop—R---S----Stop Stop—T--T

    References
    1. http://www.emunix.emich.edu/~rwinning/genetics/replic3.htm
    2. http://faculty.ccbcmd.edu/courses/bio141/lecguide/unit1/HGT/HGT.html

    This content was COPIED from BrainMass.com - View the original, and get the already-completed solution here!

    © BrainMass Inc. brainmass.com December 24, 2021, 11:12 pm ad1c9bdddf>
    https://brainmass.com/biology/genetics-of-bacteria/bacterial-genetics-replication-547695

    Attachments

    ADVERTISEMENT