Explore BrainMass
Share

Molecular Biology - DNA & Mutant E.coli Genotypes

This content was STOLEN from BrainMass.com - View the original, and get the already-completed solution here!

Please see the attached file for full problem description.

---
1. Heparin is a polyanion that inhibits RNA transcription in vitro by binding directly to bacterial RNA polymerase (RNAP). If heparin interferes with the ability of the polymerase to bind DNA in a non-specific fashion, what subunit of RNAP is the heparin binding to?

2. The 5' end of the codon strand of a prokaryote gene is diagramed below.
+1
GACATAAACCCTTTGGGTTGACA(N)18GCTATAATGCCTCCAGTGGGA
I II III
GGAGGTGGAATGGAACCCGAG
IV
a. Which region(s) would most likely be protected from digestion by Dnase in the presence of the RNAP holoenzyme?
b. What would be the sequence of the 5' end of the encoded mRNA?
c. Upon transcription of this DNA, which region would contain the first codon to be translated?

3. A mutant of E.coli has constitutive expression of beta-galactosidase. A partial diploid formed with this mutant and F' I^+ O^+ Z^+ has normal, inducible synthesis of beta-galactosidase. What is the genotype of the mutant?

4. A mutant of E.coli cannot synthesis beta-galactosidase or beta-galactosidase permease in the presence or absence of lactose. A partial diploid formed with this mutant and F' I^+ O^c Z^+ Y^+ also cannot be induced to synthesize either enzyme. What possible genotypes could the mutant have?

© BrainMass Inc. brainmass.com October 24, 2018, 5:11 pm ad1c9bdddf
https://brainmass.com/biology/molecular-biology/molecular-biology-dna-mutant-e-coli-genotypes-3954

Attachments

Solution Preview

1. The bacterial RNAP is composed of 5 subunits: two alphas, one beta, one beta-prime, and sigma. Sigma is involved in RNAP's DNA binding to the promoter region. If heparin prevents RNAP binding to DNA, then it must interacts with the sigma subunit of RNAP.

2. a) The RNAP binds tightly to its promoter. Two regions have to be present in the promoter: The "TATAAT box" near the -10 region, and the TTGACA sequence near the -35 region. RNAP will bind these ...

Solution Summary

The solution answers the questions with explanation in approximately 350 words.

$2.19
See Also This Related BrainMass Solution

Principles of Genetics

ANGLIA RUSKIN UNIVERSITY

DEPARTMENT OF LIFE SCIENCES
Principles of Genetics MOD002804

Assessment 2

Part A: Questions from the Drosophila melanogaster cross practical
1) Present the results of the Drosophila cross in a suitable format. Include your results and class results. (5)
2) Explain why a reciprocal cross might be carried out in an experiment like this. (4)
3) Research the genetic basis of vestigial wings in Drosophila melanogaster. (2)
4) Carry out a Chi square test of the class results based on what you found out about the genetics. Write a null hypothesis and show all of the steps clearly. State whether you should accept or reject the null hypothesis and state your conclusion. (10)

Part B: Questions from the polytene chromosomes practical
1) From your own observations in the practical, estimate the width of a polytene chromosome on your slide. (2)
2) What are polytene chromosomes and why do they arise? (10)
3) Research other species and tissues where polytene chromosomes have been found. (10)
4) Discuss the nature of "puffs" that occur in polytene chromosomes during development. (10)

Part C: Questions from the bacterial transformation practical
1) How much DNA in ng was added to each tube of bacteria? If 250pg of DNA was required, how many l would have been needed? Show your workings clearly. (6)
2) In week 1 of the practical, plasmids were introduced into competent bacteria and plated onto selective media. Present the results of your findings in an appropriate way and state which plasmid contains which resistance gene? (10)
3) Calculate the transformation efficiency for each of the transformations you performed. Show your workings clearly. (5)

Transformation efficiency (transformants/g) = Number of colonies on plate
g of DNA per transformation

5l of plasmid at 2ng/l were used per transformation.

4) What factors may affect transformation efficiency and why? (8)
5) Present results of the gel electrophoresis including labels for each lane. (6)
6) Give an estimate for the sizes of the plasmids in base pairs. (2)

Please do not exceed the word count of 1000 words. This word count does not include titles, tables, legends, figures or references.

A further 10 marks are available for references, presentation, clarity, depth of understanding and scientific content.

This assessment is due in Thursday 5th December 5pm.

Helen McRobie 2013

View Full Posting Details