Molecular Biology - DNA & Mutant E.coli Genotypes
Not what you're looking for?
Please see the attached file for full problem description.
---
1. Heparin is a polyanion that inhibits RNA transcription in vitro by binding directly to bacterial RNA polymerase (RNAP). If heparin interferes with the ability of the polymerase to bind DNA in a non-specific fashion, what subunit of RNAP is the heparin binding to?
2. The 5' end of the codon strand of a prokaryote gene is diagramed below.
+1
GACATAAACCCTTTGGGTTGACA(N)18GCTATAATGCCTCCAGTGGGA
I II III
GGAGGTGGAATGGAACCCGAG
IV
a. Which region(s) would most likely be protected from digestion by Dnase in the presence of the RNAP holoenzyme?
b. What would be the sequence of the 5' end of the encoded mRNA?
c. Upon transcription of this DNA, which region would contain the first codon to be translated?
3. A mutant of E.coli has constitutive expression of beta-galactosidase. A partial diploid formed with this mutant and F' I^+ O^+ Z^+ has normal, inducible synthesis of beta-galactosidase. What is the genotype of the mutant?
4. A mutant of E.coli cannot synthesis beta-galactosidase or beta-galactosidase permease in the presence or absence of lactose. A partial diploid formed with this mutant and F' I^+ O^c Z^+ Y^+ also cannot be induced to synthesize either enzyme. What possible genotypes could the mutant have?
Purchase this Solution
Solution Summary
The solution answers the questions with explanation in approximately 350 words.
Solution Preview
1. The bacterial RNAP is composed of 5 subunits: two alphas, one beta, one beta-prime, and sigma. Sigma is involved in RNAP's DNA binding to the promoter region. If heparin prevents RNAP binding to DNA, then it must interacts with the sigma subunit of RNAP.
2. a) The RNAP binds tightly to its promoter. Two regions have to be present in the promoter: The "TATAAT box" near the -10 region, and the TTGACA sequence near the -35 region. RNAP will bind these ...
Purchase this Solution
Free BrainMass Quizzes
Pregnancy Knowledge
How much do you know about being pregnant? Test your Pregnancy IQ with this quiz!
Breast Milk and Breastfeeding
How much do you know about breast milk and breastfeeding? Double check your knowledge level with this quiz!
Comfort Measures For Labor
Are you ready to doula someone through labor?
Do You Know Your Macromolecules?
This quiz will assess your knowledge of the macromolecules that are important to living things.
Creating a Birth Plan
Preparing for a birth and want to make sure that you're including all the right information? Use this quiz to get on the right track and check your birth plan knowledge!