Biology/Genetics Questions
Not what you're looking for?
Biology/Genetics Questions. See attached file for full problem description.
Purchase this Solution
Solution Preview
1. Obviously, transcription must occur first in order to make a mRNA. Then, the mRNA leaves the nucleus and goes to the cytoplasm. A small ribosomal subunit binds to the mRNA followed by the binding of the met-tRNA to the mRNA. Then, the large subunit joins in, and only then can translation be intiated.
-------------------------------------------
2a. The start codon is 5'-AUG. It must be in that orientation. You can see it about 5 bases in from the left side.
2b. Stop codons are 5'-UGA, UAA, and UAG. You can see a UAA about 5 bases in from the right side.
2cd. The coding portion is:
AUG, GGC, AAU, AAA, CCG, GGC, CAG
Looking up these codons, we end up with:
N-Met-Gly-Asn-Lys-Pro-Gly-Gln-C
A protein is always translated from the N-terminus to the C-terminus.
2e. In order to work out the template DNA strand, you have to base pair the mRNA to the original DNA just making sure that you don't have any uracil in it, but rather thymine.
Here is the mRNA:
5' GGCGAUGGGCAAUAAACCGGGCCAGUAAGC
Therefore, here's the DNA:
3'-CCGCTACCCGTTATTT GGCCCGGTCATTCG
-------------------------------------------
3A. If the operator is mutated so that the repressor can no longer bind, then the genes of the operon will always be "on." Remember, the repressor binds to the operator and turns the operon "off." Therefore, if the operator can't bind the repressor, then the genes of the operon can never be "off." They'd be ...
Purchase this Solution
Free BrainMass Quizzes
Vision and Oculomotor Control
This quiz will test the student's knowledge of the neural underpinnings of the visual system and its central pathways.
Infant Development: Sleep
How much do you know about infant sleep? Test your knowledge with this quiz.
Breastfeeding Basics
How much do you know about breastfeeding? Find out with this quiz!
Labor Comfort Measures
Do you know how to comfort someone in labor?
Identifying Variables in Science Experiments, Part 2
Using sample experiments, test yourself to see if you can identify independent, dependent, and controlled variables. Identifying variables is key in understanding and developing experiments. The questions are biology related, but this can be applied to any area of science.