Purchase Solution

DNA complementary strand

Not what you're looking for?

Ask Custom Question

Which of the following nucleotide sequences represents the complement to the DNA strand 5' AGATCCG-3'?

a. 5' AGATCCG-3'
b. 3' AGATCCG-5'
C. 5' CTCGAAT -3'
D. 3' CTCGAAT- 5'
E. 3' TCTAGGC- 5'

Purchase this Solution
Solution Summary

This solution answers a multiple choice question relating the sequence of nucleotides necessary to achieve a complementary strand.

Purchase this Solution
Free BrainMass Quizzes
The Transfer of Energy in an Ecosystem

This quiz will assess your knowledge of how energy is transferred in an ecosystem and the different levels of trophic organization.

How Much Do You Know About Genetic Inheritance?

Most of us studied the basics of dominant and recessive genes at some point. However, genetics are much more complicated than this. How far beyond the basics does your knowledge go?

Birth 101

Do you know about childbirth? Find out with this quiz.

Creating a Birth Plan

Preparing for a birth and want to make sure that you're including all the right information? Use this quiz to get on the right track and check your birth plan knowledge!

Parts of the Brain

This quiz will test your knowledge on different areas of the brain.

View More Free Quizzes
Related BrainMass Solutions

  • Complimentary base paring in DNA

    143414 Complimentary base paring in DNA Given the following DNA sequence, determine the complementary strand that would be added in replication: ATTGCATGATAGCC GIVEN THE FOLLOWING DNA SEQUENCE, DETERMINE THE COMPLEMENTARY STRAND THAT WOULD BE ADD IN

  • Sequencing of DNA or RNA

    108279 Sequencing of DNA or RNA Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following: i) Is this a strand of DNA or RNA? How do you know? ii) If DNA, what is the complementary strand?

  • complementary base pairing in DNA

    60072 DNA What data obtained from the chemical analysis of dna supported the idea of complementary base pairing in dna?

  • DNA Replications, Testing, and PCR

    DNA polymerase is required to extend and produce the new complementary strand of DNA.

  • DNA: What is the Sequence of Nucleotides

    218848 DNA: What is the Sequence of Nucleotides If one strand of DNA is found to have the sequence 5' AACGTACTGC 3', what is the sequence of nucleotides on the 3' --> 5 strand (complementary strand)? 5' -> 3': AACGTACTGC 3' -> 5' :TTGCATGACG.

  • DNA replication

    339936 DNA replication and semiconservative replication Which of the following best describes semiconservative replication? a. the translation of a DNA molecule into a complementary strand of RNA b.

  • Transcription and Translation of a DNA Sequence

    4161 Transcription and Translation of a DNA Sequence The following DNA sequence is on the template strand of a DNA molecule being transcribed: T A C C G A T G A C C G A T T A. What is the complementary RNA strand that is formed? B.

  • DNA structure

    60039 DNA How many total hydrogen bonds would exist between the ff. strands of DNA and the complementary strands? a.) GCATGC b.) TATGGC A strand of DNA has the base sequence GCTTAG. Write the base sequence for the complementary strand.

  • Complimentary sequence prediction

    Given strand - 5′ AACGTACGTAC 3′ Complementary strand - 3′TTGCATGCATG 5′ m- RNA template - 5′ AACGTACGTAC 3′ The expert examines complimentary sequence predictions for DNA strands.

View More Related Solutions