Triplet codons and probability

Related BrainMass Solutions

• Predicting triplets in laboratory conditions

  The independent probability of A is 5/6 and of G is 1/6.

• Amino Acids and Codons

  3 nucleotides code for each amino acid and the triplet code is known as a codon or coding unit. In 150 amino acid residues the number of codons present = 150/3 = 50. The amino acids and codons are examined.

• DNA encodes proteins

  Divide the protein molecular weight by the average molecular weight of an amino acid to get the number of amino acids in the protein: 69000 Da / 120 Da = 575 amino acids Therefore, with 1.1x10E5 codons, and 575 amino acids, the total number of different

• Amino acid number prediction following mRNA sequence

  codons representing the amino acids] a) 1 à?

• Genetics-From genes to protein, mutations.

  The last codon encode the stop codon that is usually signal the stop of the transcript What meaning do these mRNA codons have for protein synthesis? Explanation: The mRNA codons are usually in triplet code that codes for amino acids.

• If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein?

  codons are different.

• Question about DNA code

  What is the mRNA sequence, and the amino acid sequence?? In order to solve this problem, we must understand basic base pairing rules in nucleic acids. Thymine base pairs with adenine and guanine base pairs with cytosine.

• Transcription

  Response: All you need to do is look up the codons on the chart and write them down in order, like this: met--trp--phe--trp--met ATG-TGG-TTT-TGG-ATG (If you wanted, you could have had another triplet for phe.

• Insertion in DNA

  TACAAACGACCCCTGTAAGCACCCGT DNA gene with ΔC10 deletion AUGUUUGCUGGGGACAUUCGUGGGCA mRNA with ΔG10 deletion BUT...this does cause a problem, as the triplet codons beginning with the AUG have a problem when one base is dropped.