Share
Explore BrainMass

Find probable restriction endonuclease sites

From the sequence below, find probable restriction endonuclease sites.
HINT: The recognition sequences are 6bp long.

5' CATTCGGTACCTTCGTGAATTCTGACCAC 3'

Solution Preview

Remember that restriction enzymes generally recognize palendromic sequences. Palendromic sequences are sequences that read the same on both template and complementary strands. An example of this is: 5' GAATTC 3'. If you take the ...

$2.19