Purchase Solution

DNA Sequences: Separate the Codons Into Triplets

Not what you're looking for?

Ask Custom Question

For each of the same DNA sequence below, write the sequence of messenger RNA codons that is syntheisized during transcription. Separate the codons into triplets.

DNA molecule #1 TAC CGG ATG CCA GAT CAA ATC
mRNA #1: ___________________________

DNA molecule #2 TAC GGG GGC GTA ACC ACA ACT
mRNA #2 __________________________

DNA molecule #3 TAC CTG TTA AGC TAC AAA ATT
mRNA #3: __________________________.

Purchase this Solution
Solution Summary

The solution assists with separating the codons into triplets in the DNA sequences.

Solution Preview

For each of the same DNA sequence below, write the sequence of messenger RNA codons that is syntheisized during ...

Purchase this Solution
Free BrainMass Quizzes
Feeding Babies

Do you know the science behind feeding babies? Test your knowledge with this quiz.

Pregnancy Knowledge

How much do you know about being pregnant? Test your Pregnancy IQ with this quiz!

Understanding the Musculoskeletal system

Introduce and understand basic information how the skeletal system and muscular system work in close concert with one another. And how their interaction between muscle and bone, as they work together to allow us movement.

Infant Development: Sleep

How much do you know about infant sleep? Test your knowledge with this quiz.

How Well Do You Know Your Body?

This quiz will assess the different systems of the human body. It will examine everything from the organs to the cellular processes that occur.

View More Free Quizzes
Related BrainMass Solutions

  • Sequencing of DNA or RNA

    To make it easy, let's separate the sequence into triplets (codons) like this: 5'- AUG CUA UCA UUG ACC UUG AGU UAU UAA -3' Now, we look up these codons and indicate what the sequence would be.

  • Question about DNA code

    DNA = TACTTACCGAGATTCTTGTTTATC RNA = AUGAAUGGCUCUAAGAACAAAUAG Now, that we know the mRNA sequence, we look up triplets on the genetic code table. Remember, the mRNA triplets are called codons.

  • What would be the base sequence of RNA after transcription occurs?

    A) Step 1 - Transcription: During the process of transcription, the information in the DNA codons of a gene is transcribed into RNA. Suppose that gene X has the DNA base sequence 3'-TACCCTTTAGTAGCCACT-5'.

  • Mutations in DNA/RNA, Cystic Fibrosis, and Meiosis

    325426 DNA mutations, transcription, translation, cystic fibrosis probability, meiosis mutations Transcription: During the process of transcription, the information in the DNA codons of a gene is transcribed into RNA.

  • DNA Mutation

    Stop codons only work because there is no tRNA with an anti-codon for the stop codons' sequences. In this case, the stop codon UGA does not have a corresponding ACT anticodon on a tRNA.

  • DNA/MRNA Genetics, Traits, Cells Divisions

    A) Step 1 - Transcription: During the process of transcription, the information in the DNA codons of a gene is transcribed into RNA. Suppose that gene X has the DNA base sequence 3'-TACCCTTTAGTAGCCACT-5'.

  • Genetics-From genes to protein, mutations.

    Transcribe and translate EACH of the three following DNA gene sequences. Turn these in using the graphic organizer. The letters represent the DNA N-base sequences of the genes. The first is the original gene.

  • Transcription

    If we delete that A, everything comes back into phase for the final triplet. To find out the mRNA sequences, just use the DNA as your template and change the Ts to Us.

  • Various Basic Genetics Questions and Solutions

    A) Step 1 - Transcription: During the process of transcription, the information in the DNA codons of a gene is transcribed into RNA. Suppose that gene X has the DNA base sequence 3â??-TACCCTTTAGTAGCCACT-5â??.

View More Related Solutions