Primer explanation for Factor V Leiden
Not what you're looking for?
A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).
I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?
Purchase this Solution
Solution Summary
The solution provides explanation for primers used for Factor V Leiden.
Solution Preview
The forward primer anneals to 1581 to 1602 in exon 10 and the ...
Purchase this Solution
Free BrainMass Quizzes
Understanding the Musculoskeletal system
Introduce and understand basic information how the skeletal system and muscular system work in close concert with one another. And how their interaction between muscle and bone, as they work together to allow us movement.
Vision and Oculomotor Control
This quiz will test the student's knowledge of the neural underpinnings of the visual system and its central pathways.
How Well Do You Know Your Body?
This quiz will assess the different systems of the human body. It will examine everything from the organs to the cellular processes that occur.
Parts of the Brain
This quiz will test your knowledge on different areas of the brain.
BIOLOGY
Basics in biology