If DNA and a base were inserted at the beginning of the 5’ end of the molecule, how would that affect protein synthesis and the resultant protein?

*5’- ATGCTATCATTGACCTTGAGTTATTAA –3’ 1) If DNA and a base were inserted at the beginning of the 5’ end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!) 2) If DNA and the G were deleted at the asterisk, how would this affect protein synthesis and the resultant ...continues

The discovery of the structure of the DNA molecule was a tumultuous process.

I have a discussion question which should be 150 words. Here is the question: The discovery of the structure of the DNA molecule was a tumultuous process. Discuss the impact that political or social influence or monetary gains can have on the progress of science.

Cytogenetics (Theoretical) Project - Sex Chromosomes

Roughly how long would it take to 'map' a 'Y' chromosome:days, weeks, months? Using FISH, human and animal X chromosomes have been compared. To look for homology, could this comparison also be done using Y chromosomes?

Cytogenetics (Theoretical) Project

Would it be possible to investigate possible homology between the Y chromosome on an animal (eg; platypus) and the Y chromosome on a human - using FISH (fluorescent in situ hybridization)?

Can females express the recessive trait in a sex-linked gene?

Can females express the recessive trait in a sex-linked gene? If so, how? Under what circumstances would this never happen? Explain.

Mendelian genetics

1.Define dominance, recessiveness and sex-linkage. 2.What are the expected phenotypic ratios for a monohybrid cross, dihybrid cross, and sex-linked trait? 3. What is pedigree analysis? How can pedigree analysis be used to predict the phenotype of offspring?

Eye Colour Mismatch in Father Regarding to Son and Grandparents

Dear sir, I have got a query about how genes are transmitted from parents to kids. The situation is: I am blue eyed, my mother is green eyed and my dad is brown eyed. This far so good, no problems: I thought,my mum is green(G)-blue(b) and my dad is brown(B)-blue, so I had 1 out of 4 of turning out being blue. It’s norma ...continues

A researcher studied six independently assorting genes in a plant.

A researcher studied six independently assorting genes in a plant. Each gene has a dominant and a recessive allele: R black stem, r red stem; D tall plant, d dwarf plant; C full pods, c con­stricted pods; O round fruit, o oval fruit; H hairless leaves, h hairy leaves; W purple flower, w white flower. From the cross (P1) Rr ...continues

Ancestry Tests

I'd just like to know: 1) are ancestry dna tests(mtDNA,Y-chromosome STR test) reliable? 2) in the case of Y-chromosome test,as long as they analyse markers on the Y chromosome,does it give ancestry only on the father of my father of my father.... or on the whole of my father's side(and his father,mother,etc.) If it gives ances ...continues

In cattle, hornless is dominant to horned, red coat color is incompletely dominant to white, where the heterzygote has a color called roan.

In cattle, hornless is dominant to horned, red coat color is incompletely dominant to white, where the heterzygote has a color called roan. What would the parental genotypes be in the following crosses? What woyld the genotypic and phenotypic ratios of the F1 be in the crosses? a. heterozygous hornless red bull X horned ro ...continues