How to Calculate Recombination Frequency
Calculate the recombination frequency between RC4-124 and RC-280 based on above numbers.
~12,000 F2 (304 orginal F2)
134 individuals with ss at one marker and ns at the other marker.were grown for phenotype.
Then the attached document, at the bottom of the first page column 2, there is some information that may help.
I don't understand how to set up the recombination frequency problem
Do I divide 134 by 12,000 and then times 100% ?
Please help me.
Thank you.
Sincerely,
Pam
This question has the following supporting file(s):
- Rice Domestication by Reducing Shattering.pdf
- question number 1.jpg
Solution Summary
Recombination frequency can be calculated with the help of known number of progeny and the total individuals.
This answer includes:
- Plain text
- Cited sources when necessary
Extracted Content from Question Files:
- Rice Domestication by Reducing Shattering.pdf
REPORTS
31. S. P. Hazen et al., Plant Physiol. 138, 990 (2005). 2000-002558 (S.C.P.). The raw data and software are Figs. S1 to S7
32. We thank E. Foss for creation of strain YEF1695, E. Smith available at http://genomics-pubs.princeton.edu/ Tables S1 to S3
for analysis of YEF1695 mapping data, and D. Storton SNPscanner/. References
and J. Matese for technical support. Supported by
Supporting Online Material
National Institute of General Medical Sciences grant R01 12 December 2005; accepted 24 February 2006
GM046406 and center grant P50 GM071508 (D.B.), NIH www.sciencemag.org/cgi/content/full/1123726/DC1 Published online 9 March 2006;
Materials and Methods
grant R37 MH059520 and James S. McDonnell Founda- 10.1126/science.1123726
SOM Text
tion grant 99-11T (L.K.), and Pew Charitable Trusts award Include this information when citing this paper.
evaluation. By progressively examining SSR and
Rice Domestication by SNP (single-nucleotide polymorphism) mark-
ers between RC4-123 and RM280, we finally
Reducing Shattering mapped the mutation responsible for the deri-
vation of nonshattering in cultivated rice to a
1.7-kb region of a gene with a previously
Changbao Li, Ailing Zhou, Tao Sang*
unknown function (Fig. 1B and table S1). The
gene is predicted to be a transcription factor,
Crop domestication frequently began with the selection of plants that did not naturally shed ripe
and its coding region is physically located be-
fruits or seeds. The reduction in grain shattering that led to cereal domestication involved genetic
tween 34,014,305 and 34,012,126 base pairs
loci of large effect. The molecular basis of this key domestication transition, however, remains
(bp) on assembly LOC_Os04 g57530 of rice
unknown. Here we show that human selection of an amino acid substitution in the predicted DNA
chromosome 4 (The TIGR Rice Genome An-
binding domain encoded by a gene of previously unknown function was primarily responsible for
notation Database).
the reduction of grain shattering in rice domestication. The substitution undermined the gene
The comparison of the 1.7-kb sequences
function necessary for the normal development of an abscission layer that controls the separation
between the mapping parents revealed seven
of a grain from the pedicel.
mutations (Fig. 1C). These include one muta-
tion in the intron: (a) a 1-bp substitution; three
ereals, the world_s primary food, were Two previous QTL studies using crosses mutations in the first exon: (b) a 15-bp or five–
C domesticated from wild grass species. between O. sativa ssp. indica and the wild amino acid insertion/deletion, (c) a 3-bp or
Because wild grasses naturally shed perennial species O. rufipogon detected four one–amino acid insertion/deletion, and (d ) a
mature grains, a necessary early step toward and five shattering QTL (8, 9). Both studies 1-bp or an amino acid substitution; and three
mutations 5¶ upstream of the start codon: (e) a
cereal domestication was to select plants that identified a QTL at the same location of sh4
could hold on to ripe grains to allow effective with either the largest or nearly largest pheno- 1-bp substitution at site -55, ( f ) a 3-bp insertion/
deletion between sites j343 and j344, and ( g)
field harvest (1, 2) (fig. S1). The selection pro- typic effect among the detected QTL. More-
an 8-bp insertion/deletion between sites j558
cess might have been mainly unconscious be- over, genetic analyses between O. sativa ssp.
and j559.
cause grains that did not fall as easily had a japonica and O. rufipogon and two other close-
better chance of being harvested and planted in ly related wild species O. glumaepetula and O. To assess the polymorphism and evolution-
the following years. Consequently, nonshattering meridionalis all found that a single dominant ary direction of these mutations, we sequenced
alleles had an increased frequency and eventual- allele from each of the three wild species was this 1.7-kb region from an additional 14 rice
ly replaced the shattering alleles during domes- responsible for grain shattering (10, 11). This cultivars representing the diversity of O. sativa
tication. The finding that one locus accounted for locus, named Sh3, was mapped to the same (14), 21 accessions of O. nivara covering the
most phenotypic variance of grain shattering chromosomal location as sh4. distributional range of the wild species (15), 6
between a cereal crop and its wild progenitor Our QTL analysis located sh4 between accessions of O. rufipogon, and 1 accession of
suggested that the domestication process could simple sequence repeat (SSR) markers RC4- each of the four remaining wild A-genome
have been initiated quickly by selection at the 123 and RM280 (5), which had a physical dis- species (Fig. 1C and table S2). The cultivars
locus (3–5). The molecular genetic basis of the tance of about 1360 kb in the O. sativa genome were polymorphic for mutation f, i.e., some of the
selection, however, has not been characterized. (12) (Fig. 1A). Because of the large and domi- cultivars had the same sequence as O. nivara. At
Rice (Oryza sativa) was domesticated from nant effect of the O. nivara allele, we were able the remaining six mutation sites, all cultivars
one or both of two closely related species—O. to phenotypically distinguish F2 individuals that shared the same sequences, which were different
nivara and O. rufipogon—distributed from from those of the O. nivara parent.
were homozygous recessive (ss) from those that
southeastern Asia to India (6, 7 ). Our recent ge- had at least one O. nivara allele of sh4 (ns and Surprisingly, three accessions of O. nivara
netic analysis of an F2 population derived be- had the same sequences as O. sativa at these six
nn), regardless of the genotypes at the remain-
tween O. sativa ssp. indica and the wild annual ing two QTL of small effect. After evaluating a sites. It was then found that plants grown from
these accessions had the nonshattering pheno-
species O. nivara identified three quantitative total of 489 F2 plants genotyped at the three
trait loci (QTL)—sh3, sh4, and sh8—responsible shattering QTL, we consistently found that type. Greenhouse observations indicated that
for the reduction of grain shattering in culti- plants with the ns and nn genotypes at sh4 these accessions had additional characteristics
vated rice (5). Of these QTL, sh4 explained shed all mature grains when hand tapped, of cultivated rice that were not found in O.
69% of phenotypic variance, and the other two whereas plants with the ss genotype at sh4 did nivara, such as upright tillers, short awns, and/
explained 6.0% and 3.1% of phenotypic var- not shed grains or only partially shed mature or photoperiod sensitivity. This suggests that
iance. The sh4 allele of the wild species caused grains under vigorous hand shaking. the three accessions are weedy rice that has
shattering and was dominant. With the reliable phenotyping method availa- received and fixed the sh4 allele from cultivars.
ble, we grew È12,000 F2 seedlings and screened The remaining accessions of the wild
for recombinants between RC4-123 and RM280 species with confirmed shattering differed
Department of Plant Biology, Michigan State University,
(13). Plants with the genotype of ss at one marker invariably from the cultivars by one mutation,
East Lansing, MI 48824, USA.
and ns at the other were selected, and a total of d, which was a nucleotide substitution of
*To whom correspondence should be addressed. E-mail:
134 individuals were grown for phenotypic G for T or an amino acid substitution of
sang@msu.edu
1936 31 MARCH 2006 VOL 311 SCIENCE www.sciencemag.org
REPORTS
asparagine for lysine in O. sativa. At the substitution at site d was selected for the quence identity with sh4, and two Arabidopsis
remaining five mutation sites, sequence poly- development of nonshattering cultivars during genes (NP_174416 and NP_181107) with
morphism was found within the wild species rice domestication. 32% and 29% identity with sh4. None of
(Fig. 1C). That is, some of the wild accessions The Blast search of the GenBank for protein these genes has been functionally character-
shared the same sequence with cultivated rice sequences identified three predicted genes that ized. The two Arabidopsis genes were pre-
at these sites but had the shattering phenotype. are most similar to sh4. These include a rice dicted to be transcription factors (16), and one
The results thus indicate that the amino acid gene (XP_469180) with 32% amino acid se- of them had a cDNA sequence (AAT99796) in
the database. The next most similar group of
genes was also from rice and Arabidopsis but
Fig. 1. Molecular cloning of had only 20 to 22% amino acid sequence
sh4. (A) Chromosomal loca- identity with sh4.
tion of sh4 determined by Examination of the sh4 protein, using pro-
QTL mapping. Dotted lines grams Prosite and PredictNLS, identified a
indicate 1-lod (logarithm of Myb3 DNA binding domain and a nuclear
the odds ratio for linkage)
localization signal (Fig. 1D), suggesting that
supporting interval. (B) Fine
sh4 is a transcription factor. To test this
mapping of sh4. Vertical
hypothesis, we fused the gene for a green
lines indicate SSR and SNP
fluorescent protein (GFP) with sh4 to make
markers. Numbers above
sh4-GFP, which was driven by a Ubi promoter
lines: markers numbered
in the plasmid construct. The construct was
consecutively according to
introduced into a japonica cultivar, Taipei
the order of evaluation;
numbers below lines: the
number of recombinants left
in the chromosomal interval
still containing sh4 after the
evaluation of the marker.
White horizontal arrows in-
dicate the orientation and
size of open reading frames
between markers 5 and 6.
The mutation responsible for
nonshattering was mapped
to between markers 9 and
11, in a predicted gene with
two exons (black bars) and
an intron (gray bar). The
start and stop codons of the
gene are labeled. Lines be-
low illustrate two constructs
made for gene transfor-
mation; red and blue repre-
sent sequences of O. nivara
and O. sativa, respectively.
(C) Seven mutations found
between the mapping par-
ents are labeled a through g.
Variation at these sites is
compared between rice culti-
vars and wild A-genome
species in the phylogenetic
context; s and n represent
sequences of O. sativa and
O. nivara parents, respec-
tively. The number of ac-
cessions of a species with
the same combination of
sequences is indicated. (D)
sh4 protein sequence of
O. sativa. Mutations between Fig. 2. Subcellular localization of sh4. Roots of rice
cultivar Taipei 309 transformed with Ubi::sh4-GFP
the mapping parents are
were stained with 4¶-6-diamidino-2-phenylindole
indicated: red for substi-
tution (mutation d; K in O. nivara) and blue for insertion/deletion (mutation b and c; deletion in (DAPI) and observed under various conditions. (A)
O. nivara). The predicted Myb3 DNA binding domain is underlined. The predicted nuclear localization A differential interference contrast image of epi-
dermal cells. (B) The same cells showing the DAPI-
signal is colored green. The sh4-GFP construct for subcellular localization encodes a recombined
protein beginning from the sh4 N terminus to the amino acid E (colored orange) followed by GFP. stained nuclei. (C) The same cells showing the
Abbreviations for the amino acid residues are as follows: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; nuclear localization of sh4-GFP fluorescence. (D)
The merged image. Bar, 10 mm.
H, His; I, Ile; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr.
1937
www.sciencemag.org SCIENCE VOL 311 31 MARCH 2006
REPORTS
309, a rice strain tested as suitable for gene prevailed in O. nivara, which left few grains to and ripe fruits, is fundamental to plant func-
transformation (17). The nuclear localization of measure. In O. sativa, the force measured on tion and adaptation and is regulated by an
GFP-tagged sh4 was determined (Fig. 2). This day 18 was about half of that required at the abscission zone at the juncture of the organ
result supports the bioinformatic prediction that earlier stages; it then decreased at a rather slow and the main body of the plant. The molecular
sh4 is a transcription factor. pace but did not reach the level permitting grain genetic control of the abscission zone devel-
Reverse transcription–polymerase chain re- shattering in O. nivara. opment, however, is poorly understood. The
action (RT-PCR) detected the expression of sh4 We conducted rice transformation to confirm study of dicotyledonous plants such as bean,
at the flower and pedicel junction, where ma- the gene function and to test the role of the tomato, and Arabidopsis showed that an ab-
ture grains separate from the mother plant (Fig. amino acid substitution. We made two con- scission zone encompassed several layers of
3A). Gene expression was not detected in the structs that had the O. sativa promoter and small, densely cytoplasmic cells. In response
remaining parts of flowers or pedicels or in the recombined coding regions between the map- to environmental and hormonal signals, the
leaves. We amplified, using RT-PCR, the entire ping parents. The two constructs differed only activation of abscission is coupled with cell
coding region of sh4 cDNA from both mapping at the mutation site d. Construct 1 contained O. expansion and secretion of hydrolytic en-
nivara sequence from the 3¶ nontranslated region zymes that break the middle lamella between
parents. The comparison of the cDNA sequences
showed that the intron was spliced from the same to the inclusion of mutation site d and O. sativa cell layers in the abscission zone (18).
sequence from mutation site e to the 5¶ regulatory In monocotyledons, including grasses, little
position as predicted by rice genome annotation.
We conducted real-time PCR to compare the region. Construct 2 contained O. nivara sequence is known about the development and function of
from 3¶ to the inclusion of mutation site c and O. abscission zones. Genes regulating the develop-
relative levels of sh4 expression at various stages
sativa sequence from mutation site d to the 5¶ mental processes have not been identified. Here
of flower and seed development in both map-
ping parents (Fig. 3B). Although there was a regulatory region (Fig. 1B). The plasmids were we found that the abscission zone between a rice
trend of increased gene expression as seeds introduced into Taipei 309. grain and the pedicel consists of mostly one
matured, a substantial increase began 12 days af- The expression of the introduced constructs layer of small, thin-walled cells. O. nivara has a
ter pollination. The expression in O. sativa in the transgenic plants was verified by RT-PCR complete layer of abscission cells between the
continued to increase on day 18, while the identification of the 18-bp deletion of the O. grain and the pedicel, which is seen in a lon-
measurement for O. nivara was no longer pos- nivara sequence at mutation sites b and c. gitudinal section as continuous lines of abscis-
sible due to shattering. Transformants expressing construct 1 showed sion cells between the vascular bundle and the
We measured the strength of flower and significantly reduced strength of grain attach- epidermis (Fig. 4A). O. sativa, however, has an
ment to pedicel (Student_s t test, P 0 0.003), incomplete abscission layer. In the longitudinal
grain attachment to the pedicel at the corre-
sponding developmental stages. Flowers and whereas no significant difference was found section, the line of abscission cells is discon-
grains were pulled away at the interface where between transformants expressing construct 2 tinuous and completely absent near the vascular
and the control (t test, P 0 0.5) (Fig. 3D). The bundle, where they are replaced by thicker-
a mature grain separates from the pedicel, and
walled cells similar to adjacent pedicel cells
the force required was measured. For the first 9 results thus support the finding made from the
(Fig. 4, B and C). For both species, these ana-
days after pollination, the force was not signif- genetic mapping and sequence comparison that
tomical features were seen in young flowers
icantly different between the developmental the amino acid substitution at site d was
(flowers È15 days before opening were exam-
stages in either species (Fig. 3C). The force primarily responsible for the reduction of grain
ined) and remained similar in mature grains.
began to decrease in both species from day 12. shattering in rice domestication.
Because japonica cultivars are generally
The decline continued at a much faster rate in O. Programmed organ detachment, such as
harder to thresh than indica cultivars (19),
nivara than in O. sativa. On day 18, shattering the falling of old leaves, withered floral parts,
Fig. 3. Expression of sh4
and flower and grain detach-
ment. (A) RT-PCR results,
using total RNA isolated
from the flower and pedicel
junction (FP), from the re-
maining portions of pedicel
(P) and unopened flower
(F), and from leaves (L).
Above the flower, the sepa-
ration location of a mature
grain from the pedicel of O. nivara is shown. (B) Real-time RT-PCR
estimate of relative expression of sh4, using RNA isolated from leaves
(L) and the flower/grain and pedicel junction È3 days before flower
opening (j3), the day of flower opening (1), and every 3 days
thereafter during seed development. (C) Force required to pull flowers
or grains away from pedicels on the day of flower opening (1) and every
3 days thereafter during seed development. (D) Force required to pull
away grains of transformants containing the empty plasmid (control),
expressing construct 1, and expressing construct 2. Error bars, TSD.
1938 31 MARCH 2006 VOL 311 SCIENCE www.sciencemag.org
REPORTS
Taipei 309 had a stronger grain attachment to tachment in O. sativa at the late stage of grain developmental pathway of programmed cell
the pedicel than the indica mapping parent (Fig. maturation seems to suggest that the amino separation and seed dispersal in monocoty-
3, C and D). Accordingly, the abscission layer acid substitution did not knock out the gene ledonous plants and potentially for optimizing
of the japonica cultivar showed a higher degree function in cultivated rice. the methods of grain harvest.
of discontinuity and further retreat from the The slower pace of increase in the level of
vascular bundle. The transgenic plants with the sh4 expressed in O. sativa than in O. nivara
References and Notes
strength of grain attachment reduced to less than during grain maturation might have been a re- 1. J. R. Harlan, Crops & Man (American Society of
100 g had substantially improved abscission sult of selection in the regulatory region of the Agronomy, Madison, WI, 1975).
layers that were more continuous and extended gene for a finer adjustment of the shattering/ 2. J. F. Hancock, Plant Evolution and The Origin of Crop
Species (CABI, Cambridge, MA, ed. 2, 2004).
closer to the vascular bundles (Fig. 4D). threshing balance during rice cultivation. A
3. V. Poncet et al., Theor. Appl. Genet. 100, 147 (2000).
The results indicate that sh4 plays an im- comparison of the regulatory sequences of sh4, 4. A. H. Paterson, New Phytol. 154, 591 (2002).
portant role in the establishment of the ab- the levels of gene expression, and the pheno- 5. C.-B. Li, A.-L. Zhou, T. Sang, New Phytol. 170, 185
scission layer from the early stage of flower typic difference among diverse rice cultivars (2006).
6. H. I. Oka, Origin of Cultivated Rice ( Japan Scientific
development. The increased expression of sh4 should provide further insights into the genetic
Society Press, Tokyo, 1988).
in the late stage of seed maturation suggests basis of agricultural selection continued through
7. S. D. Sharma, S. Tripathy, J. Biswal, in Rice Breeding
that the gene may also play a role in the ac- the history of rice cultivation. and Genetics: Research Priorities and Challenges, J. S.
tivation of the abscission process. One or both Genetic analyses of crop domestication, Nanda, Ed. (Science Publications, Enfield, NH, 2000),
pp. 349–369.
of the roles were undermined by the amino especially the cloning of domestication-related
8. L. Xiong, K. Liu, K. Dai, C. Xu, Q. Zhang, Theor. Appl.
acid substitution of asparagine for lysine in genes, have shed a light on plant development
Genet. 98, 243 (1999).
cultivated rice. and evolution. Mutations in regulatory genes 9. H. W. Cai, H. Morishima, Theor. Appl. Genet. 100, 840
In the process of rice domestication, human were found responsible for drastic morpholog- (2000).
selection was likely to have favored mutations ical modifications during maize and tomato 10. Sobrizal, K. Ikeda, P. L. Sanchez, A. Yoshimura, Rice Genet.
Newslett. 16, 74 (1999).
that reduced grain shattering but did not domestication (20–23). Here we show that the
11. Y. S. Nagai et al., Rice Genet. Newslett. 19, 74 (2002).
eliminate the formation or function of the ab- substitution of a neutral for a positively 12. Q. Feng et al., Nature 420, 316 (2002).
scission layer. In this way, grain loss due to charged amino acid in a predicted DNA bind- 13. To screen a large number of seedlings for recombinants,
shattering was largely prevented during harvest ing domain led to a physiological transition we developed a method of rapid DNA isolation for plants
with tough leaves unsuitable for high-throughput
while a certain level of grain abscission was key to rice domestication. This is consistent
protocols (25).
maintained so that the yield increase was not with the finding that positively charged amino 14. A. J. Garris, T. H. Tai, J. Coburn, S. Kresovich, S. McCouch,
offset by creating difficulties in threshing. The acids are critical residues on the surface of Genetics 169, 1631 (2005).
inverse correlation between the expression DNA binding domains (24). The cloning of 15. D. A. Vaughan, The Wild Relatives of Rice: A Genetic
Resources Handbook (International Rice Research
level of sh4 and the strength of grain at- sh4 opens opportunities for understanding the
Institute, Philippines, 1994).
16. J. L. Riechmann et al., Science 290, 2105 (2000).
17. D. Choi, Y. Lee, H.-T. Cho, H. Kende, Plant Cell 15, 1386
(2003).
18. S. E. Patterson, Plant Physiol. 126, 494 (2001).
19. T. T. Chang, in Rice: Origin, History, Technology, and
Production, C. W. Smith, R. H. Dilday, Eds. (Wiley, New
Jersey, 2003), pp. 3–25.
20. J. Doebley, A. Stec, L. Hubbard, Nature 386, 485
(1997).
21. A. Frary et al., Science 289, 85 (2000).
22. J. Liu, J. Van Eck, B. Cong, T. D. Tanksley, Proc. Natl.
Acad. Sci. U.S.A. 99, 13302 (2002).
23. H. Wang et al., Nature 436, 714 (2005).
24. K. Yamasaki et al., Plant Cell 17, 944 (2005).
25. Materials and methods are available as supporting
material on Science Online.
26. Data have been deposited into GenBank with accession
numbers DQ383371 to DQ383414. We thank D. Choi for
helping set up rice transformation; S. Owens for
suggesting and assisting with confocal microscopy;
T. Briggeman for photographing; M. Yano for providing
plasmids; J.-P. Hu and J.-L. Fan for helping with the
subcellular localization; F. Ewers, N. Gibson, M. Grillo,
and W.-X. Zhu for discussion and comments on the
manuscript; and S. Ge, B.-R. Lu, and the International
Rice Research Institute for providing DNA samples and
plant material. The research was supported by the
National Science Foundation (USA) and the Rackham
Research Endowment Fund.
Supporting Online Material
www.sciencemag.org/cgi/content/full/1123604/DC1
Materials and Methods
Fig. S1
Tables S1 and S2
References
Fig. 4. Fluorescence images of longitudinal section of flower and pedicel junction. (A) O. nivara
mapping parent, with complete abscission layer (al). (B) O. sativa ssp. indica mapping parent, with
8 December 2005; accepted 28 February 2006
incomplete abscission layer. (C) O. sativa ssp. japonica Taipei 309, with incomplete abscission layer. (D) Published online 9 March 2006;
Transformant of Taipei 309 expressing construct 1, with improved abscission layer. f, flower side; p, 10.1126/science.1123604
pedicel side; v, vascular bundle. Bar, 50 mm. Include this information when citing this paper.
1939
www.sciencemag.org SCIENCE VOL 311 31 MARCH 2006
www.sciencemag.org/cgi/content/full/1123604/DC1
Supporting Online Material for
Rice Domestication by Reducing Shattering
Changbao Li, Ailing Zhou, Tao Sang*
*To whom correspondence should be addressed. E-mail: sang@msu.edu
Published 9 March 2006 on Science Express
DOI: 10.1126/science.1123604
This PDF file includes:
Materials and Methods
Fig. S1
Tables S1 and S2
References
Supporting Online Material
Material and Methods
Genetic mapping
An F2 population was developed from a self-fertilized F1 hybrid made between a
traditional tall cultivar of O. sativa ssp. indica (the female parent, CL16) and an individual of O.
nivara (the male parent, IRGC 80470). A total of 304 F2 individuals were used previously for
QTL mapping (5) Seeds harvested from plants propagated from the same F1 hybrid were used for
fine mapping.
DNA isolation protocol: grow 96 seedlings in a tray, add 40 µl isolation buffer (0.05%
SDS, 10mM Tris-HCl, 1 mM EDTA) in each well of a 96-well PCR plate, cut a ~5 cm leaf
segment and insert it in the corresponding well of the PCR plate, grind leaf tissues with tooth
picks, boil the plate for 2 minutes, add 120 µl water to each well, and set the plate at 4°C for
several hours. 1-2 µl of the solution was used for a 10 µl PCR to amplify DNA fragments up to
600 bp, with success rates typically higher than 90%.
RNA analyses
Total RNA was extracted from plant tissues using the RNeasy Plant Mini Kit (Qiagen).
When extracting RNA from the flower/grain and pedicel junction, the region containing 1 mm of
a pedicel and 1.5 mm of the attached flower or grain was sampled as consistently as possible in
size. A total of 20 flowers or grains were pooled in each sample. The first-strand cDNA was
synthesized from 1 µg of total RNA using a Superscript III synthesis kit (Invitrogen). Full length
cDNA was amplified from the first-strain cDNA with primers sh4-3’F (5’-
CGTCCTTGCTGCATTGCATATGATTGC) and sh4-5’R (5’-
AGCTTGCCTTGGCTCTCGCCAGTCG) and was sequenced. RT-PCR was performed with
primers 3exF (5’-ATCATCGGCCGGAGGAGTCG) and 5ex2R (5’-
GCACCACCATCACGGCCATC), located at the 3’ and 5’ sides of the intron. Actin1 was
amplified as control using primers actin1F (5’-GAAGATCACTGCCTTGCTC) and actin1R (5’-
CGATAACAGCTCCTCTTGGC). Reactions were terminated after 30 cycles.
Real-time RT-PCR was performed on the ABI Prism 7700 Sequence Detection System
(Applied Biosystems). Diluted cDNA was amplified with primers sh4RtF (5’-
CCATTGCAATCATATGCAATGCAGCA) and sh4RtR (5’-CCGATGGCCTCGATCCATGC)
using the SYBR Green PCR Core Reagent (Applied Biosystems). The levels of sh4 transcripts
were normalized by endogenous actin1 transcripts amplified with primers actin1qF (5’-
GGTACCACTATGTTCCCTGGCATT) and actin1qR (5’-
ATGCTGCTAGGAGCAAGGCAGTGA). Each set of experiments was repeated three times.
The transcripts of sh4 were quantified (S1).
Complementation test
Two constructs of sh4 were made for gene transformation (Fig. 1B). Construct 1
contained the sequence of the O. nivara parent from 438 bp downstream of the stop codon to a
Bsa I restriction site (54 -59 bp downstream of the start codon) plus the O. sativa sequence from
the Bsa I site to 2640 bp upstream of the start codon. Construct 2 contained the sequence of the
O. nivara parent from 438 bp downstream of the stop codon to an Ahd I restriction site (439 -
450 bp downstream of the start codon) plus the O. sativa sequence from the Ahd I site to 2640 bp
upstream of the start codon. Each construct was inserted into a pPZP2H-lac plasmid (S2) and
introduced into Agrobacterium tumedaciens EHA101, which was then used to infect calli
2
induced from germinating seeds of a joponica cultivar, Taipei 309. Empty plasmids were
introduced to generate control lines.
Subcellular localization
The coding sequence of a green fluorescent protein (GFP) was ligated to the Xho I site
near the 3’ end of the sh4 coding sequence of O. nivara (Fig. 1D). The construct was inserted
into a pGA1611 plasmid, in which it was driven by a Ubi promoter (S3). The plasmid was
introduced into Agrobacterium tumedaciens LBA4404, which was then transformed into Taipei
309. Roots of the transgenic plants were stained with 4'-6-Diamidino-2-phenylindole (DAPI )
and examined with a Zeiss Axio fluorescence microscope.
Measure of force separating flower/grain from pedicel
A panicle was hung vertically upside down. A light container was clasped onto a flower
or grain. Objects with known weight were placed into the container until the flower or grain was
pulled away from the pedicel. For an individual plant, a total of 100 flowers or grains from five
panicles were measured. For transgenic plants, measurement was made on panicles that
flowered approximately 30 days earlier.
Confocal microcopy
A longitudinal section was made by hand-cut through the flower/grain and pedicel
junction and stained with acridine orange. Sections were observed under a Zeiss LSM 5 Pascal
laser scanning microscope. A 488-nm argon ion laser line was used for excitation and
fluorescence images were simultaneously detected using a band-pass 505-530-nm emission filter
3
(represent in green) and a long-pass 650-nm emission filter (represented in red). Stacks of
confocal optical sections were taken, and the images were compiled with a maximum intensity
algorithm (software Version 3.2 SP2, Carl Zeiss International).
Supporting references
S1. M.W. Pfaffl, Nucleic Acids Res. 29, 2002 (2001).
S2. T. Fuse, T. Sasaki, M. Yano, Plant Biotech. 18, 219 (2001).
S3. H.-G. Kang, J.-S. Jeon, S. Lee, G. An. Plant Mol. Biol. 38, 1021 (1998).
4
Supplementary Tables
Table S1. SSR and SNP markers for fine mapping (Fig. 1B). SNP positions are based on O.
sativa sequence.
Marker Type PCR Primers (5’ – 3’) and SNP position
tcgatgttcgccatggctgc, gctggctaaacgaggcgaga
1 SSR
agttgagaggacatcaggac, cgtgacatttgttcaggcat
2 SSR
cagaaaacattgcatttcagg, gatctaacggaagaaatacac
3 SSR
catctcgtatttggctcatc, gattctactcattaaacacgc
4 SSR
agaagcgaacgaatggacag, gatctcttggagttcgggga
5 SSR
tacaccgtacttgttggacg, cagtggagctactagcatcc
6 SSR
tctcatgctatcttgtgctc, gaacggagtatattgcaagt
7 SSR
aagtgatgaaactgtggtgg, gctctaccatatgagctaca (for sequencing)
8 SNP
9 SNP a 1-bp insertion/deletion in the intron, 98 bp from the end of the first exon
10 SNP a nucleotide substitution 1,028 bp upstream of the start codon
11 SNP a nucleotide substitution 755 bp upstream of the start codon
12 SNP a nucleotide substitution 558 bp upstream of the start codon
13 SNP a nucleotide substitution in the intron, 37 bp from the end of the first exon
5
Table S2. Accessions of A-genome Oryza species compared for sequences at the mutation sites
(Fig. 1C). Numbers without leading letters are IRGC numbers. *mapping parents.
Species Accession Source Country Phenotype
a b c d e g
O. sativa ssp. indica CL16* China s s s s s s non-shattering
58278 Afghanistan s s s s s s non-shattering
6294 India s s s s s s non-shattering
50490 Brazil s s s s s s non-shattering
9148 Thailand s s s s s s non-shattering
BL272 China s s s s s s non-shattering
GLA 4 GenBank s s s s s s non-shattering
O. sativa ssp. japonica Taizhong 65 Taiwan s s s s s s non-shattering
Taipei 309 Taiwan s s s s s s non-shattering
38994 Brazil s s s s s s non-shattering
PI 392539 Australia s s s s s s non-shattering
PI 392542 USA s s s s s s non-shattering
PI 458474 Nigeria s s s s s s non-shattering
1715 USA s s s s s s non-shattering
BL377 China s s s s s s non-shattering
BL446 China s s s s s s non-shattering
Nipponbare GenBank s s s s s s non-shattering
O. sativa ssp. javanica Au8234 Vietnam s s s s s s non-shattering
103838 Bangladesh s s s s s s non-shattering
O. nivara
105894 Bangladesh s s s s s s non-shattering
106185 India s s s s s s non-shattering
80470* India n n n n n n shattering
105859 Thailand n n n n n n shattering
101967 India n n s n n n shattering
104658 Thailand n n s n n s shattering
105391 Thailand n n s n n s shattering
105742 Cambodia n n s n n s shattering
105801 Thailand n n s n n s shattering
105867 Thailand n n s n n s shattering
103422 Sri Lanka n s s n n s shattering
104687 India n s s n n s shattering
104697 India n s s n n s shattering
105319 India n s s n n s shattering
105417 Sri Lanka n s s n n s shattering
105454 Sri Lanka n s s n n s shattering
105702 Nepal n s s n n s shattering
105703 Nepal n s s n n s shattering
105705 Nepal n s s n n s shattering
105706 Nepal n s s n n s shattering
106345 Myanmar n s s n n s shattering
104311 Thailand n n s n n s shattering
O. rufipogon
80505 India n s s n n s shattering
105953 Indonesia n s s n n s shattering
106122 India n s s n n s shattering
80534 India s s s n n s shattering
80529 India n s s n s s shattering
105672 Brazil n s s n n s shattering
O. glumaepatula
101196 Cameroon n s s n n s shattering
O. barthii
101198 Cameroon n s s n n s shattering
O. longistaminata
101145 Australia n s s n n s shattering
O. meridionalis
6
Supplementary Figure
Fig. S1. Phenotype. (A) Shattering of O. nivara when a panicle was tapped. (B) Non-shattering
of O. sativa when a panicle was vigorously shaken.
7
